The effect of intravenous remdesivir on endometrial receptivity in female mice

Jamileh Sadat Mirsanei; Azam Govahi; Zahra Abroodi; Rana Mehdizadeh; Ronak Shabani; Mehdi Mehdizadeh; Marziyeh Ajdary

doi:10.5653/cerm.2026.09138

Clin Exp Reprod Med > Epub ahead of print

Mirsanei, Govahi, Abroodi, Mehdizadeh, Shabani, Mehdizadeh, and Ajdary: The effect of intravenous remdesivir on endometrial receptivity in female mice

Original Article

Clinical and Experimental Reproductive Medicine 2026;cerm.2026.09138.

Published online: September 9, 2026

DOI: https://doi.org/10.5653/cerm.2026.09138

The effect of intravenous remdesivir on endometrial receptivity in female mice

Jamileh Sadat Mirsanei^1,²

, Azam Govahi³, Zahra Abroodi^1,², Rana Mehdizadeh⁴, Ronak Shabani⁵, Mehdi Mehdizadeh⁵

, Marziyeh Ajdary³

¹Department of Anatomy, Iran University of Medical Sciences, Tehran, Iran

²Student Research Committee, School of Medicine, Iran University of Medical Sciences, Tehran, Iran

³Endometriosis Research Center, Iran University of Medical Sciences, Tehran, Iran

⁴Islamic Azad University Central Tehran Branch, School of Dentistry Tehran Iran School of Dentistry, Central Tehran Branch, Islamic Azad University, Tehran, Iran

⁵Reproductive Sciences and Technology Research Center, Department of Anatomy, Iran University of Medical Sciences, Tehran, Iran

Corresponding author: Mehdi Mehdizadeh Reproductive Sciences and Technology Research Center, Department of Anatomy, Iran University of Medical Sciences, Tehran, Iran
Tel: +98-2188622689 Fax: +98-2188622689 E-mail: mehdizadeh.m@iums.ac.ir

Co-corresponding author: Marziyeh Ajdary Endometriosis Research Center, Iran University of Medical Sciences, Tehran, Iran
Tel: +98-2166509283 Fax: +98-2166509283 E-mail: ajdari.m@iums.ac.ir

*The authors received specific funding for this work from Iran University of Medical Sciences (1401-3-99-24033).

Received December 27, 2025 Revised April 26, 2026 Accepted June 10, 2026

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objective

Pregnant women with coronavirus disease 2019 (COVID-19) are more likely than nonpregnant women to require admission to an intensive care unit, and many may require antiviral therapy. Remdesivir, an antiviral drug used to treat COVID-19, may exert toxic effects on specific tissues and organs. Therefore, this study investigated the effects of remdesivir on endometrial tissue in pregnant female mice.

Methods

Thirty female Naval Medical Research Institute (NMRI) mice were divided into five groups. The control group received no treatment, and the sham group received the remdesivir solvent, dimethyl sulfoxide. The 2-, 4-, and 8-mg groups received the corresponding doses of remdesivir. Treatment continued for 10 days. After injection and mating, the presence of a vaginal plug was considered to indicate gestational day 1. On gestational day 4.5, uterine tissue damage, pinopode status, serum estradiol levels, and tissue expression of interleukin-6 and interleukin-1β were examined.

Results

Serum estradiol levels and interleukin-6 expression in endometrial tissue decreased in a dose-dependent manner after remdesivir treatment. Remdesivir treatment was also associated with fewer uterine pinopodes and histological evidence of endometrial tissue injury (p<0.05).

Conclusion

In pregnant mice, remdesivir reduced serum estradiol levels, decreased the number of endometrial pinopodes, and suppressed interleukin-6 expression. These findings suggest that remdesivir may adversely affect the endometrium and potentially compromise implantation; however, direct functional validation is required.

Keywords: COVID-19; Endometrial injury; Remdesivir

Introduction

Coronavirus disease 2019 (COVID-19) can cause severe illness, underscoring the need for drug therapies that reduce symptoms, accelerate recovery, and prevent death [1]. According to the U.S. Centers for Disease Control and Prevention, from January 22 to June 7, 2020, 9% of women with COVID-19 were pregnant, and 9%–14% of these women had severe or critical illness. Pregnant women with COVID-19 are also more likely than nonpregnant women to require admission to an intensive care unit [2].

Remdesivir (RDV) is an antiviral drug that inhibits RNA virus replication by targeting RNA-dependent RNA polymerase. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), an RNA virus, can also be inhibited by RDV [1]. The U.S. Food and Drug Administration approved RDV as the first antiviral drug for COVID-19 [3]. RDV has shown activity against SARS-CoV-2 replication in cultured cells and in animal and human models [4,5]. However, some studies have reported that RDV may exert toxic effects on specific tissues and organs, indicating the need for further investigation of the underlying mechanisms [3,6,7].

Successful implantation requires bidirectional crosstalk between the embryo and the endometrium [8]. Defects in this communication can lead to implantation failure, a major problem in reproductive medicine and an important cause of infertility. Uterine receptivity is regulated by the ovarian hormones estrogen and progesterone, which also influence cytokines and growth factors involved in embryo–uterine interactions during implantation [9]. Factors that affect the embryo, uterus, or these regulatory mediators may therefore impair implantation. To date, information on the adverse reproductive effects of RDV, particularly on embryo implantation, remains limited, partly because reproductive toxicity is difficult to assess. Evaluating drug-related adverse effects during pregnancy is especially challenging because pregnant women and women planning pregnancy are typically excluded from human clinical trials [10,11]. In a study evaluating the effect of RDV on pregnant mouse embryos during organogenesis, embryos exposed to RDV showed growth retardation and skeletal abnormalities [12]. In a study of 67 hospitalized pregnant women with COVID-19 who were treated with RDV, 33% experienced adverse events, 18% of which were serious and mostly pregnancy-related [2]. In another study of five pregnant patients, one patient discontinued RDV after six doses because of worsening transaminitis [13]. In contrast, a study of six pregnant women with Ebola virus disease who received RDV reported no adverse events [14]. Overall, human data on the effects of RDV during pregnancy remain very limited. Available data suggest a lower risk of adverse events during the second and third trimesters, but little is known about exposure during the first trimester [15].

As COVID-19 continues to circulate, many women of reproductive age may require antiviral treatment while also wishing to preserve fertility. Therefore, the potential reproductive toxicity of RDV warrants further investigation. To our knowledge, no study has evaluated the effects of RDV on implantation, and its effects on endometrial function remain poorly understood. This study evaluated the effects of RDV on the endometrium in pregnant mice.

Methods

1. Animals and study groups

Thirty adult female Naval Medical Research Institute (NMRI) mice, 8 weeks old and weighing 25–35 g, were obtained from the Experimental Studies Center at Iran University of Medical Sciences, Tehran, Iran. All experimental procedures followed National Institutes of Health guidelines and were approved by the Research Ethics Committee of Iran University of Medical Sciences (ethics code: IR.IUMS.AEC.1402.036). The animals were maintained under controlled laboratory conditions, including a 12-hour light/12-hour dark cycle, a constant temperature of 22–25 °C, and ad libitum access to food and water.

2. Drug preparation and administration

RDV (batch No. CB48011; Ronak Daru Pharmaceutical Company) was freshly prepared and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich). After a 3-day acclimatization period, the mice were randomly assigned to five groups of six mice each and treated for 10 days.

• Control group: No treatment was administered.
• Sham group: DMSO was administered intravenous once daily at a volume similar to that used in the RDV-treated groups.
• RDV 1 group: RDV was administered intravenous once daily at a dose of 2 mg.
• RDV 2 group: RDV was administered intravenous once daily at a dose of 4 mg.
• RDV 3 group: RDV was administered intravenous once daily at a dose of 8 mg.

After the treatment period, female mice were paired with reproductively active male mice of the same strain. The next morning, the mice were examined for the presence of a vaginal plug, which was considered to indicate gestational day 1 (GD 1). On GD 4.5, mice were euthanized after administration of ketamine and xylazine (100 and 10 mg, respectively; intravenous), and the uterine horns were collected for further examination. All analyses were performed by a skilled technician who was blinded to the experimental groups.

3. Histological studies

Uterine specimens were fixed in 10% formalin for 72 hours and then processed for paraffin embedding. Sections were cut at a thickness of 5 mg/kg using a microtome (DS8402; Didsabz), stained with hematoxylin and eosin (H&E), and examined under a light microscope.

4. Pinopode examination using scanning electron microscopy

To examine the luminal surface of the endometrium, tissues were first fixed in 2.5% glutaraldehyde for 2 hours at 4 °C. The samples were then dehydrated using increasing ethanol concentrations of 50%, 70%, 96%, and 100% and dried by the critical-point method. A thin layer of gold was subsequently applied to the sample surfaces. Surface imaging was performed using a scanning electron microscope (AIS2100; Seron Technology).

5. RNA isolation, cDNA synthesis, and quantitative real-time polymerase chain reaction

The expression of genes involved in the inflammatory pathway, including interleukin-6 (IL-6) and IL-1β, was evaluated using quantitative real-time polymerase chain reaction (PCR). Technical replicates were performed in triplicate for all samples. Total RNA was extracted from endometrial tissue using TRIzol reagent (Millipore Sigma, Sigma-Aldrich), followed by chloroform-mediated phase separation. The quantity and quality of the isolated RNA were evaluated using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.). RNA purity and concentration were determined spectrophotometrically using the A260/A280 ratio. Complementary DNA (cDNA) was then synthesized from the extracted RNA using a Fermentas kit (Thermo Fisher Scientific). Real-time quantitative PCR was conducted using SYBR Green (Takara Bio) on a real-time PCR system (Corbett Research). Each 10-µL reaction mixture contained 250 ng of cDNA and 5 pmol of each forward and reverse primer. Relative gene expression was calculated using the 2^−ΔΔCt method, with β-actin as the internal reference gene. The primer sequences are shown in Table 1.

6. Serum hormone and cytokine assays

Blood was collected from each mouse by cardiac puncture. Serum was separated by centrifugation at 5,000 ×g for 15 minutes at room temperature and stored at −80 °C. Estradiol, IL-6, and IL-1β concentrations were measured using enzyme-linked immunosorbent assay kits for estradiol (KGE014; R&D Systems), IL-6 (MLB00C-1; R&D Systems), and IL-1β (M6000B; R&D Systems). Absorbance was measured at 450 nm using a microplate reader (Garni 3200). Cytokine and hormone concentrations were calculated from standard curves.

7. Statistical analysis

Data were analyzed using GraphPad Prism 8.0 (GraphPad Software Inc.). Normality was assessed using the Kolmogorov–Smirnov test. Differences among groups were evaluated using one-way analysis of variance followed by Tukey’s post hoc test. Results are reported as the mean±standard deviation. Statistical significance was defined as p<0.05.

Results

1. Effects of remdesivir on serum reproductive hormone levels

As shown in Figure 1, mean serum estradiol levels were significantly lower in animals treated with RDV at 2, 4, or 8 mg than in the control group (p<0.05). Serum estradiol levels decreased significantly as the RDV dose increased (p<0.05).

2. Endometrial morphology with H&E staining: histological findings in the control and sham groups

Examination of tissue sections from the control and sham groups showed that the mucosal epithelium had a uniform, simple columnar structure. No vacuoles were observed in the subepithelial layer. The number of lymphocytes was within the expected range, and no significant inflammatory change was observed. The blood vessels in this region did not differ from the normal state in number or dilation. No extravascular red blood cells were observed, indicating the absence of an inflammatory process in the control and sham groups (Figure 2A, 2B). In the 2-mg group, slight histological changes were observed compared with the control group. The epithelium maintained its normal structure, although minor changes were present, including increased lymphocyte numbers and vascular alterations. These findings suggest the onset of an inflammatory process in this group (Figure 2C). In the 4-mg group, histological changes were more pronounced than those in the control and low-dose groups. In some areas, the epithelium had lost its uniformity and normal morphology. Vacuoles were observed in the subepithelial layer. Blood vessels in this region were markedly increased in number and showed severe dilation, suggesting exacerbation of the inflammatory process in this group (Figure 2D). The most severe tissue changes were observed in the 8-mg group. The number of lymphocytes in the subepithelial region was markedly increased. In some areas, the epithelium was disrupted and separated from the underlying layer. Red blood cells were also observed between tissue cells and outside blood vessels. Together with vascular rupture, these findings suggest severe inflammation and extensive tissue damage in the high-dose group (Figure 2E).

3. Effects of remdesivir on pinopodes

Figure 3 shows scanning electron microscopy images of the endometrial ultrastructure and the endometrial pinopode score in mice. Endometrial pinopodes were significantly reduced as the RDV dose increased.

4. Effects of remdesivir on IL-1β and IL-6 gene expression

As shown in Figure 4, mean IL-1β expression was lower in animals receiving 4 mg RDV than in the control and sham groups; however, this difference was not statistically significant (p<0.05). Mean IL-1β expression was higher in animals receiving 2 and 8 mg RDV than in the control and sham groups, but these differences were also not statistically significant (p<0.05). In contrast, mean IL-6 expression was significantly lower in animals receiving 2, 4, or 8 mg RDV than in the control and sham groups (p<0.05).

Discussion

This study showed that administration of RDV at doses of 2, 4, and 8 mg for 10 days in adult female mice was associated with a dose-dependent reduction in serum estradiol levels. The histological alterations observed, including lymphocyte infiltration, vascular dilation, and epithelial disruption, are more consistent with a nonspecific inflammatory or toxic insult than with selective impairment of the endometrial receptivity program. Therefore, the reductions in pinopodes and IL-6 expression may represent downstream consequences of broader RDV-associated inflammatory injury rather than direct, specific effects on implantation-related pathways. Under the influence of estradiol secreted by the ovaries, the endometrium enters a proliferative state. Estradiol levels and the estradiol-to-progesterone ratio regulate estrogen receptors and progesterone receptors in endometrial cells. During the receptive window, estrogen receptor α is downregulated in the endometrial epithelium, reducing responsiveness to estradiol and preventing blastocyst rejection. Through estrogen receptors, estradiol induces the expression of genes involved in the cell cycle, tissue remodeling, and signaling, all of which are essential for endometrial preparation. Pinopodes are transient protrusions on the surface of endometrial epithelial cells that appear late in the receptive phase, after initial estradiol exposure and under progesterone dominance. Their appearance is associated with increased progesterone and a relative decrease in estradiol during the receptive phase [16]. Pinopodes mark the receptive window and are thought to contribute to uterine fluid uptake and close contact with the blastocyst. Through progesterone receptors, progesterone activates pathways such as hedgehog, homeobox A10 (HOXA10), and Indian hedgehog, which are essential for cell differentiation and pinopode formation. At implantation, a local, controlled inflammatory response is initiated by endometrial cells and uterine immune cells, including macrophages and uterine natural killer cells. Leukotrienes, especially leukotriene B4, and cyclooxygenase-2 are derived from arachidonic acid [17]. Cytokines such as IL-11, leukemia inhibitory factor, and transforming growth factor β also contribute to this process. Estradiol and progesterone can increase cyclooxygenase-2 expression and prostaglandin estradiol production, promoting vasodilation and increased vascular permeability at the implantation site. This controlled inflammation is essential for extracellular matrix remodeling, increased blood flow, and blastocyst adhesion and invasion. Key genes induced alongside pinopode formation and inflammation include leukemia inhibitory factor, which is essential for endometrial receptivity and implantation and is upregulated by estradiol and progesterone. HOXA10 and HOXA11 are progesterone-induced transcription factors that are critical for uterine development and endometrial receptivity. Integrins, such as αVβ3, are adhesion molecules expressed on epithelial cell surfaces and contribute to blastocyst adhesion. Insulin-like growth factor-binding protein 1 is secreted by the endometrial stroma and helps regulate trophoblast invasion. Protease inhibitors, such as plasminogen activator inhibitor 1, are important for regulating matrix degradation and controlled blastocyst invasion [18]. Previous studies have indicated that ovarian steroids, including estrogen and progesterone, play a critical regulatory role by activating molecular modulators and supporting embryo implantation [19]. During implantation, ovarian steroids alter endometrial morphology and function, thereby mediating blastocyst attachment [20]. Successful implantation therefore depends on both hormone concentrations and receptor expression [21,22].

An elevated estrogen-to-progesterone ratio controls the expression of integrin molecules that are essential for blastocyst attachment to the uterine epithelium [23]. Estrogen can also induce endometrial angiogenesis [24]. The dose-dependent reduction in estradiol observed in this study is consistent with the possibility that higher RDV doses may disrupt hormonal signaling and reduce the expression of endometrial adhesion molecules necessary for endometrial receptivity.

During the window of receptivity, balloon-shaped projections called pinopodes form on the uterine surface in humans, rats, and mice. These structures are therefore useful indicators of endometrial receptivity. Studies have shown a direct correlation between pinopode number and implantation rate, although the biological role of pinopodes remains unclear.

During implantation, pinopodes interdigitate with microvilli on the syncytiotrophoblast layer of the blastocyst. These outgrowths can be readily identified using scanning electron microscopy [25]. In mice, pinopodes begin to develop on day 3.5 of pregnancy, 1 day before embryo implantation, and their population peaks by day 8.5 [21]. Therefore, we imaged the endometrium of mice on GD 4.5. Scanning electron microscopy of endometrial ultrastructure showed fewer pinopodes in the RDV-treated groups, a finding that previous studies suggest is associated with a reduced likelihood of implantation. In the present study, endometrial pinopodes decreased substantially as the RDV dose increased.

This study showed that mean IL-6 expression was lower in mice treated with all three RDV doses. This finding suggests that RDV may adversely affect endometrial receptivity and, consequently, fertility in NMRI mice. Consistent with our findings, a study of IL-6-deficient mice showed that IL-6 plays an important role during implantation, with reduced IL-6 leading to decreased implantation and fertility. In addition, the presence of IL-6 receptors on the endometrium and blastocyst supports a paracrine and autocrine role for IL-6 during implantation in murine species [26]. In humans, IL-6 receptor expression during the menstrual cycle suggests that IL-6 may also influence endometrial receptivity and implantation beyond a strictly species-specific mechanism [19].

Previous studies have suggested that immunological and inflammatory responses are elicited during the implantation window. Before blastocyst arrival, endometrial stromal cells release proinflammatory cytokines, including tumor necrosis factor α and IL-1β, to initiate an inflammatory response [27]. Therefore, detection of these key initiators of inflammatory and immunological reactions may help predict implantation [28]. IL-1β mediates human in vitro decidualization and induces uterine natural killer cells to release chemokines and other factors required for implantation [29]. Local macrophages also enhance fucosylated structures by releasing leukemia inhibitory factor and IL-1β, which promotes trophectoderm adhesion to the uterine surface before embryo implantation [30-32]. IL-1β and tumor necrosis factor α also regulate trophoblastic matrix metalloproteinases 2, 3, and 9, thereby contributing to trophoblast invasion into the endometrium [33-35]. Sequeira et al. [36] reported that pregnancy after in vitro fertilization was positively correlated with high IL-1β levels in day 3 culture-conditioned medium, supporting a role for embryonic IL-1β in implantation. In the present study, mean IL-1β expression tended to increase in the 2- and 8-mg RDV-treated groups, whereas mean IL-1β expression decreased in the 4-mg RDV-treated group compared with the control and sham groups; however, these differences were not statistically significant (p<0.05). Several factors may explain these findings. First, the relatively small sample size in each group may have limited the statistical power to detect meaningful differences. Second, high within-group variability may have masked true between-group differences. Third, RDV may have only a small biological effect on IL-1β expression, requiring a larger animal sample or more sensitive analytical methods for confirmation. Therefore, our findings suggest that RDV may have potential biological effects on IL-1β expression, but further studies with larger cohorts and reduced variability are required to determine whether these observations are statistically significant.

Despite its significant findings, this study had several limitations. Molecular markers of endometrial receptivity, such as leukemia inhibitory factor, HOXA10, and integrins, were not directly measured because of financial constraints. Therefore, the interpretations remain correlational and do not establish a direct causal relationship between RDV exposure and impaired endometrial receptivity. The most important limitation is the absence of functional implantation assays, such as counting implantation sites on GD 7–8. Therefore, we cannot definitively conclude that RDV causes implantation failure. This study provides only correlative histological, hormonal, and gene expression data. Conclusions about actual reproductive outcomes require future functional studies. Other important factors involved in endometrial receptivity and related signaling pathways were also not examined. In addition, this study assessed mice only up to day 4.5 after mating. Future studies should include longer follow-up intervals to evaluate actual pregnancy outcomes, including implantation rate, ongoing pregnancy, and live birth. Further research on molecular markers and fertility outcomes could improve understanding of the underlying mechanisms and inform appropriate clinical strategies.

Future studies should consider functional tests, such as mouse implantation models; comprehensive hormonal profiling, including progesterone measurement; more extensive immune and stromal analyses, such as immunohistochemistry for macrophages and uterine natural killer cells; and rescue experiments using anti-inflammatory agents or growth factors.

In pregnant mice, RDV reduced serum estradiol levels, decreased the number of endometrial pinopodes, and suppressed IL-6 expression. These findings suggest that RDV may adversely affect endometrial tissue and impair endometrial receptivity; however, functional implantation studies are required before concluding that RDV causes implantation failure.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

The authors gratefully acknowledge financial support from Iran University of Medical Sciences.

Author contributions

Conceptualization: JSM, AG, MM, MA. Formal analysis: ZA, RM, RS. Data curation: ZA, RM, RS. Funding acquisition: MM. Visualization: ZA, RM, RS. Software: ZA, RM, RS. Validation: MM, MA. Investigation: MM, MA. Supervision: MM, MA. Writing-original draft: JSM, AG. Writing-review & editing: MM, MA.

Figure 1.

Remdesivir at doses of 2, 4, and 8 mg altered serum estradiol (E2) levels in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnotes indicate significant differences compared with the control group: ^a)p<0.05; ^b)p<0.001.

Figure 2.

Hematoxylin and eosin staining of endometrial tissue. (A) Control group, (B) sham group, (C) 2-mg group, (D) 4-mg group, and (E) 8-mg group. Black arrows indicate lymphocyte accumulation. Black arrowheads mark the epithelial layer. Stars denote multiple blood vessels. Yellow arrowheads indicate vacuoles beneath the epithelium. White arrows indicate red blood cells between tissue cells.

Figure 3.

Remdesivir at doses of 2, 4, and 8 mg altered the pinopode score in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnote indicates significant differences compared with the control group: ^a)p<0.05.

Figure 4.

Remdesivir at doses of 2, 4, and 8 mg altered (A) interleukin-1β (IL-1β) and (B) interleukin-6 (IL-6) gene expression in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. ^a)p<0.05; ^b)p<0.001.

Table 1.

Primer sequences for IL-6, IL-1β, and β-actin

Gene	Subgroup	Sequence (5′→3′)	Length (nt)	Tm (°C)	GC%	Self-complementarity	Self-3′ complementarity
IL-6	Forward	AGACTTCCATCCAGTTGCCTT	21	59.29	47.62	3.00	0.00
IL-6	Reverse	TTCCACGATTTCCCAGAGAACA	22	59.63	45.45	5.00	3.00
IL-1β	Forward	TGCCACCTTTTGACAGTGATGA	22	59.38	45.45	5.00	2.00
IL-1β	Reverse	TTGATGTGCTGCTGCGAGATT	21	60.42	45.45	3.00	2.00
β-actin	Forward	CAAGATCATTGCTCCTCCTG	20	60.95	47.62	4.00	2.00
β-actin	Reverse	ATCCACATCTGCTGGAAGG	19	57.3	52.60	6.00	0.00

IL, interleukin; nt, nucleotide; Tm, melting temperature; GC%, guanine–cytosine content.

References

1. Kokic G, Hillen HS, Tegunov D, Dienemann C, Seitz F, Schmitzova J, et al. Mechanism of SARS-CoV-2 polymerase stalling by remdesivir. Nat Commun 2021;12:279.

2. Burwick RM, Yawetz S, Stephenson KE, Collier AY, Sen P, Blackburn BG, et al. Compassionate use of remdesivir in pregnant women with severe coronavirus disease 2019. Clin Infect Dis 2021;73:e3996-4004.

3. Bjork JA, Wallace KB. Remdesivir; molecular and functional measures of mitochondrial safety. Toxicol Appl Pharmacol 2021;433:115783.

4. Goldman JD, Lye DC, Hui DS, Marks KM, Bruno R, Montejano R, et al. Remdesivir for 5 or 10 days in patients with severe COVID-19. N Engl J Med 2020;383:1827-37.

5. Pagliano P, Sellitto C, Scarpati G, Ascione T, Conti V, Franci G, et al. An overview of the preclinical discovery and development of remdesivir for the treatment of coronavirus disease 2019 (COVID-19). Expert Opin Drug Discov 2022;17:9-18.

6. Akinci E, Cha M, Lin L, Yeo G, Hamilton MC, Donahue CJ, et al. Elucidation of remdesivir cytotoxicity pathways through genome-wide CRISPR-Cas9 screening and transcriptomics. bioRxiv [Preprint] 2020 Aug 28. https://doi.org/10.1101/2020.08.27.270819

7. Fan Q, Zhang B, Ma J, Zhang S. Safety profile of the antiviral drug remdesivir: an update. Biomed Pharmacother 2020;130:110532.

8. Govahi A, Nasr-Esfahani MH, Amjadi F, Mahdevar M, Mehdizadeh R, Mehdizadeh M. Cutting-edge techniques provide insights regarding repeated implantation failure patients. Reprod Biomed Online 2023;46:687-96.

9. Hamid HY, Zakaria MZ. Embryo implantation: shedding light on the roles of ovarian hormones, cytokines and growth factors in the implantation process. Afr J Biotechnol 2012;11:16297-304.

10. European Medicines Agency. Summary on compassionate use: remdesivir gilead [Internet]. EMA; 2020 [cited 2026 Jul 20]. Available from: https://www.ema.europa.eu/en/documents/other/summary-compassionate-use-remdesivir-gilead_en.pdf

11. Jorgensen SC, Davis MR, Lapinsky SE. A review of remdesivir for COVID-19 in pregnancy and lactation. J Antimicrob Chemother 2021;77:24-30.

12. Atta M, Bakery A, Adel M, Fadl A. Developmental toxicity induced by prenatal exposure to remdesivir in pregnant female rats and their offspring. Egypt Acad J Biol Sci B Zool 2024;16:105-20.

13. McCoy JA, Short WR, Srinivas SK, Levine LD, Hirshberg A. Compassionate use of remdesivir for treatment of severe coronavirus disease 2019 in pregnant women at a United States academic center. Am J Obstet Gynecol MFM 2020;2:100164.

14. Mulangu S, Dodd LE, Davey RT, Tshiani Mbaya O, Proschan M, Mukadi D, et al. A randomized, controlled trial of Ebola virus disease therapeutics. N Engl J Med 2019;381:2293-303.

15. Lampejo T. Remdesivir for the treatment of COVID-19 in pregnancy. J Med Virol 2021;93:4114-9.

16. Yang Y, Ru H, Zhang S, Wu C, Dong J, Wang X, et al. The effect of granulocyte colony-stimulating factor on endometrial receptivity of implantation failure mouse. Reprod Sci 2025;32:200-17.

17. Karimi S, Baharaghdam S, Danaii S, Yousefi M. Embryo-maternal cross-talk: key players in successful implantation and live birth rates. Reprod Biol Endocrinol 2025;23:136.

18. Li J, Liu H, Lim J, Xing H, Chen Y, Yang S, et al. Molecular and biological markers for assessing endometrial receptivity in infertile women: a narrative review. J Int Med Res 2025;53:3000605251328893.

19. Singh M, Chaudhry P, Asselin E. Bridging endometrial receptivity and implantation: network of hormones, cytokines, and growth factors. J Endocrinol 2011;210:5-14.

20. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, et al. Molecular cues to implantation. Endocr Rev 2004;25:341-73.

21. Lessey BA. Two pathways of progesterone action in the human endometrium: implications for implantation and contraception. Steroids 2003;68:809-15.

22. Ma WG, Song H, Das SK, Paria BC, Dey SK. Estrogen is a critical determinant that specifies the duration of the window of uterine receptivity for implantation. Proc Natl Acad Sci USA 2003;100:2963-8.

23. Basak S, Dhar R, Das C. Steroids modulate the expression of alpha4 integrin in mouse blastocysts and uterus during implantation. Biol Reprod 2002;66:1784-9.

24. Demir R, Yaba A, Huppertz B. Vasculogenesis and angiogenesis in the endometrium during menstrual cycle and implantation. Acta Histochem 2010;112:203-14.

25. Abd ElFattah LI. Pinopodes. Egypt J Histol 2012;35:633-9.

26. Robertson SA, O'Connell A, Ramsey A. The effect of interleukin-6 deficiency on implantation, fetal development and parturition in mice. In: Proceeding of the 31st Annual Conference of the Australian Society for Reproductive Biology; 2000 Apr 26-30; Canberra, Australia.

27. Hinduja I, Pathare AD, Zaveri K, Hinduja I. Immunological approach of personalized treatment for recurrent implantation failure patients undergoing IVF. Glob J Reprod Med 2018;5:65-7.

28. Salama KM, Alloush MK, Al Hussini RM. Are the cytokines TNF alpha and IL 1beta early predictors of embryo implantation?: cross sectional study. J Reprod Immunol 2020;137:102618.

29. Prutsch N, Fock V, Haslinger P, Haider S, Fiala C, Pollheimer J, et al. The role of interleukin-1b in human trophoblast motility. Placenta 2012;33:696-703.

30. Nakamura H, Jasper MJ, Hull ML, Aplin JD, Robertson SA. Macrophages regulate expression of a1,2-fucosyltransferase genes in human endometrial epithelial cells. Mol Hum Reprod 2012;18:204-15.

31. Jasper MJ, Care AS, Sullivan B, Ingman WV, Aplin JD, Robertson SA. Macrophage-derived LIF and IL1B regulate alpha(1,2)fucosyltransferase 2 (Fut2) expression in mouse uterine epithelial cells during early pregnancy. Biol Reprod 2011;84:179-88.

32. Robertson SA, Moldenhauer LM. Immunological determinants of implantation success. Int J Dev Biol 2014;58:205-17.

33. Cohen M, Meisser A, Haenggeli L, Bischof P. Involvement of MAPK pathway in TNF-alpha-induced MMP-9 expression in human trophoblastic cells. Mol Hum Reprod 2006;12:225-32.

34. Staun-Ram E, Goldman S, Gabarin D, Shalev E. Expression and importance of matrix metalloproteinase 2 and 9 (MMP-2 and -9) in human trophoblast invasion. Reprod Biol Endocrinol 2004;2:59.

35. Meisser A, Chardonnens D, Campana A, Bischof P. Effects of tumour necrosis factor-alpha, interleukin-1 alpha, macrophage colony stimulating factor and transforming growth factor beta on trophoblastic matrix metalloproteinases. Mol Hum Reprod 1999;5:252-60.

36. Sequeira K, Espejel-Nunez A, Vega-Hernandez E, Molina-Hernandez A, Grether-Gonzalez P. An increase in IL-1b concentrations in embryo culture-conditioned media obtained by in vitro fertilization on day 3 is related to successful implantation. J Assist Reprod Genet 2015;32:1623-7.