Nrf2-ARE signaling pathway as a key regulator of oxidative stress and antioxidant responses in granulosa cells in polycystic ovary syndrome

Article information

Korean J Fertil Steril. 2026;.cerm.2025.07927
Publication date (electronic) : 2026 January 2
doi : https://doi.org/10.5653/cerm.2025.07927
1Anatomical Sciences Research Center, Institute for Basic Sciences, Kashan University of Medical Sciences, Kashan, Iran
2Department of Medicine, Yazd Branch, Islamic Azad University, Yazd, Iran
Corresponding author: Hossein Nikzad Anatomical Sciences Research Center, Institute for Basic Sciences, Kashan University of Medical Sciences, Kashan, Iran Tel: +98-9137430153‎ E-mail: nikzad.kaums@gmail.com
*This work was supported by Kashan University of Medical Science, Kashan, Iran (KAUMS/402101).
Received 2025 February 27; Revised 2025 August 4; Accepted 2025 August 30.

Abstract

Objective

Polycystic ovary syndrome (PCOS) is a metabolic and endocrine disorder that frequently results in infertility due to ovulatory dysfunction. Granulosa cells (GCs), which are essential for oocyte maturation, are highly vulnerable to oxidative stress (OS)-induced damage. The nuclear factor erythroid-2-related factor 2 (NRF2)-antioxidant responsive element (ARE) pathway, a major antioxidant mechanism, may help protect GCs from OS. This study investigated NRF2-ARE pathway activity in GCs of PCOS patients compared to healthy fertile controls.

Methods

In total, 46 follicular fluid and GC samples were collected from 28 patients diagnosed with PCOS and 18 fertile women aged 20–40 years. After RNA extraction, expression levels of antioxidant genes— heme oxygenase 1 (HO1), peroxiredoxin 1 (PRDX1), superoxide dismutase 1 (SOD1), thioredoxin (TXN), NRF2, and kelch like ECH associated protein 1 (KEAP1)—were measured using quantitative reverse transcription polymerase chain reaction. In addition, total antioxidant capacity (TAC) and nitric oxide (NO) levels were analyzed in follicular fluid, with statistical comparisons performed using the t-test.

Results

In GCs of PCOS patients, HO1 expression was downregulated, while PRDX1, SOD1, NRF2, TXN, and KEAP1 were upregulated. NO activity was elevated, and TAC levels were significantly decreased in the follicular fluid of PCOS patients.

Conclusion

These findings demonstrate a significant association between antioxidant gene expression in GCs and PCOS. The results suggest that OS plays a critical role in the development and progression of PCOS.

Introduction

Infertility is defined as the inability to achieve pregnancy after 18 months of regular unprotected sexual intercourse [1,2]. It can arise from male-related factors, female-related factors, combined issues, or unknown causes. Female infertility may result from hormonal disturbances, premature ovarian failure, genital tract infections, endometriosis, fallopian tube disorders, congenital uterine abnormalities, and polycystic ovary syndrome (PCOS) [3,4]. Among women with infertility, approximately 25% of cases are attributed to ovulatory disorders, and 70% of those with anovulation are diagnosed with PCOS [5]. PCOS is a complex and heterogeneous syndrome and is among the most prevalent endocrine and metabolic disorders. Its development involves a multifactorial interplay of genetic and environmental factors that remain incompletely understood. Clinically, PCOS is characterized by menstrual irregularities, chronic amenorrhea, hormonal imbalance, polycystic ovaries, and hirsutism [6]. Granulosa cells (GCs) play a central role in follicular development and oocyte maturation. During follicle rupture and ovulation, neutrophils and macrophages release high levels of reactive oxygen species (ROS) [7]. Because GCs are highly sensitive to oxidative stress (OS)-induced injury, the absence of effective defense mechanisms may lead to multiple cellular dysfunctions that impair female fertility [8]. Therefore, an efficient antioxidant system in GCs is essential to counteract oxidative damage, prevent apoptosis, and reduce follicular atresia during ovulation. These cells possess an advanced antioxidant defense network that safeguards oocytes against disturbances in homeostasis [9]. Both enzymatic and non-enzymatic antioxidant systems are present in GCs, providing critical protection under OS conditions [10]. Among the endogenous antioxidant mechanisms, the nuclear factor erythroid-2-related factor 2 (NRF2)-antioxidant responsive element (ARE) pathway has received considerable attention for its protective role in GCs [11,12]. During follicular growth and ovulation, GCs establish intrinsic defense mechanisms, including activation of the NRF2-ARE pathway, to withstand various stressors [13]. The antioxidant defense system is largely regulated by the ARE, a promoter sequence activated within the NRF2-ARE pathway. Once NRF2, the master transcription factor, is activated, it translocates to the nucleus and binds to the ARE region, initiating the transcription of antioxidant enzymes. This process enhances cellular resilience to OS [14]. ‎Key genes regulated by or involved in this pathway, essential for maintaining redox balance, include those that encode the antioxidant enzymes peroxiredoxin 1 (PRDX1), superoxide dismutase 1 (SOD1), thioredoxin (TXN), and heme oxygenase 1 (HO1), as well as the transcription factor NRF2 and its major negative regulator kelch like ECH associated protein 1 (KEAP1)‎ [12,15]. To further understand the role of OS in conditions such as PCOS, researchers frequently analyze biomarkers in follicular fluid (FF), including nitric oxide (NO) and total antioxidant capacity (TAC). FF forms the immediate microenvironment of the oocyte, directly affecting oocyte quality, early embryo development, and implantation potential. It is thought that antioxidant capacity increases during folliculogenesis, with larger follicles demonstrating greater developmental competence [16]. Inadequate antioxidant defenses in FF can impair these processes, thereby reducing fertility potential [17]. TAC, which reflects the integrated antioxidant potential of FF, is a reliable measure of its ability to neutralize ROS [18]. NO also plays a dual role in reproductive physiology. It induces inflammatory responses required for ovulation and acts as a paracrine signal in regulating reproductive and implantation processes. However, excessive NO may inhibit steroidogenesis in luteal and GCs, potentially disrupting ovarian function [19]. In this context, the antioxidant defense system—particularly the NRF2-ARE pathway—plays a vital role in shielding GCs from OS and preserving ovarian function. Assessing OS and antioxidant biomarkers in FF provides important insight into oocyte quality and fertility outcomes, especially in PCOS, where OS is markedly elevated.

Methods

1. Study population

A total of 28 individuals diagnosed with PCOS were included in the study. PCOS diagnosis was based on the 2004 Rotterdam Consensus Criteria; however, phenotypic sub-classification was not performed. Thus, it is possible that different PCOS phenotypes were represented within the patient group. Additionally, 18 fertile women without PCOS were enrolled as the control group.

2. Sample size

Before initiating the study, a power analysis was conducted using G*Power software ver. 3.1 (Heinrich Heine University) to determine the appropriate sample size needed to detect significant differences in gene expression between PCOS and control groups. Drawing on prior literature reporting moderate to large effect sizes (Cohen’s d=1.0), and using a significance level (α) of 0.05 with power (1–β) set at 0.80, the analysis indicated a minimum of 17 samples per group was required. Therefore, the final sample sizes of 28 PCOS patients and 18 control subjects were considered sufficient to achieve adequate statistical power.

3. Inclusion and exclusion criteria

Exclusion criteria included women with infertility due to ovarian tumors or cysts, chromosomal abnormalities, hyperprolactinemia, or other metabolic disorders. Inclusion criteria comprised women aged 20 to 40 years with a confirmed clinical diagnosis of PCOS, as well as fertile women without PCOS (with infertility attributed to male factors) who were referred to the infertility center of Beheshti Hospital in Kashan for intracytoplasmic sperm injection (ICSI)/in vitro fertilization (IVF) treatment, serving as the control group. Both the PCOS and control participants underwent comparable controlled ovarian stimulation protocols during their ICSI/IVF cycles. This approach ensured uniformity in sample collection and minimized variability related to the stimulation process.

4. Ethical considerations

The study received approval from the Ethics Committee of Kashan University of Medical Sciences (approval number: IR.KAUMS.MEDNT.REC.1402.132), all procedures performed in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki Declaration and its later amendments. All participants were fully informed about the study objectives, and written informed consent was obtained before sample or data collection. Socio-demographic and health-related data were collected using structured questionnaires.

5. Sample collection

Following standard IVF laboratory protocols, the dominant follicle was first identified via ultrasound. During oocyte retrieval, the follicle was aspirated by a gynecologist and transferred to the IVF laboratory. After oocyte isolation, GCs and FF were collected under a microscope by an embryologist. GCs were preserved in RNAlater Ambion (Thermo Fisher Scientific) solution and stored at −80 °C for RNA extraction. FF samples were also stored at −80 °C for antioxidant assays.

6. Real-time polymerase chain reaction and gene expression analysis

Total RNA was extracted from GCs using Trizol, and RNA concentration was quantified with a NanoDrop 2000 Spectrophotometer. Complementary DNA (cDNA) synthesis was performed using SuperScript III Reverse Transcriptase. Polymerase chain reaction (PCR) amplification was conducted with SYBR Green PCR Mix and the GoTaq 1-Step reverse transcription quantitative polymerase chain reaction (RT-qPCR) system. Primer sequences were designed with Primer3 software (https://primer3.org/), validated for specificity using the Nucleotide BLAST program, and synthesized by Pishgam Company (Tables 1 and 2). Thermal cycling conditions for cDNA quantification followed the Mic qPCR Cycler system (Bio Molecular Systems), with a final reaction volume of 10 μL. Gene expression data were normalized to the endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the 2-ΔΔCT method, and fold changes were calculated for comparative analysis.

Primer sequences for quantitative real-time polymerase chain reaction

Means and standard deviations of gene expression in the PCOS and control groups

7. Estimation of NO activity

NO, a biologically active molecule, is rapidly oxidized to nitrite and nitrate. Consequently, nitrite levels were measured as a reliable indicator of NO production. Nitrite concentrations were quantified using the colorimetric Griess assay, which employs a mixture of 0.1% naphthyl-ethylenediamine and 2% sulfanilamide. In brief, 100 μL of each supernatant was combined with 100 μL of Griess reagent and incubated at room temperature for 30 minutes. Absorbance was then measured at 540 nm.

8. Determination of TAC

Total antioxidant capacity (TAC) was assessed colorimetrically according to a previously established protocol [20]. Briefly, 1.5 mL of ferric reducing antioxidant power reagent (composed of 25 mL of 0.3 M sodium acetate buffer, pH 3.6; 2.5 mL of 0.01 M 2,4,6-tri(2-pyridyl)-1,3,5-triazine [TPTZ] in 0.04 M HCl; and 2.5 mL of 0.02 M FeCl3•6H2O, pre-heated to 37 °C) was added to 50 μL of each supernatant. The mixture was incubated at 37 °C for 15 minutes, after which absorbance was recorded at 593 nm.

9. Statistical methods

All experimental data were analyzed using GraphPad Prism 9 and Microsoft Excel. Quantitative results are presented as mean±standard deviation. Before comparative analyses, the Shapiro–Wilk test was applied to assess data normality, and the Levene test was used to verify homogeneity of variances. Depending on the results, group comparisons were performed using the Student t-test for normally distributed data with equal variances or non-parametric alternatives (e.g., Mann–Whitney U test) when assumptions of parametric testing were not met.

Results

1. Expression of the HO1, PRDX1, SOD1, TXN, NRF2, and KEAP1 genes in PCOS patients

The association between the expression of the HO1, PRDX1, SOD1, TXN, NRF2, and KEAP1 genes and PCOS was thoroughly examined. Expression of the HO1 gene was significantly reduced in PCOS patients compared to controls (p=0.0259). In contrast, PRDX1 expression was significantly elevated in the PCOS group (p=0.0196), as shown in Table 2.

Expression of the SOD1 gene was also increased in PCOS patients relative to controls (p=0.0418). TXN expression demonstrated a marked elevation in the PCOS group (p=0.0001). Similarly, NRF2 expression was significantly upregulated (p=0.0430) in PCOS patients. In addition, KEAP1 expression was higher in the PCOS group than in controls (p=0.0310).

2. Determination of NO activity

NO activity was analyzed in both PCOS patients and the control group. As shown in Table 3, mean NO activity levels (µM) were significantly elevated in the PCOS group compared to controls (p=0.0222). These findings are also illustrated in Figure 1.

Means and standard deviation of NO and TAC activity in the FF for the patient and control groups

Figure 1.

Antioxidant activity in the follicular fluid of the polycystic ovary syndrome (PCOS) and control groups. (A) The left scale plots nitric oxide (NO) values, whereas (B) the right scale shows total antioxidant capacity (TAC). Bars represent standard deviation. a)p<0.05; b)p<0.001.

3. Determination of TAC status

TAC levels were measured in FF samples from PCOS patients and controls (Figure 1). TAC was significantly reduced in the PCOS group compared to controls (p=0.0005), as summarized in Table 3.

Discussion

In this study, qRT-PCR analysis was performed on GC samples from both PCOS patients and controls to evaluate the expression of HO1, PRDX1, SOD1, TXN, NRF2, and KEAP1. Figure 2 illustrates the association between the expression of these genes and PCOS. The findings revealed that HO1 expression was significantly downregulated in PCOS GCs, whereas other NRF2-associated genes (PRDX1, SOD1, TXN, NRF2, and KEAP1) were markedly upregulated. This divergence may reflect distinct upstream regulatory mechanisms. Although HO1 is primarily regulated by NRF2, its expression is also influenced by pro-inflammatory cytokines such as interleukin-6 and tumor necrosis factor-α, as well as by epigenetic modifications. Within the ovarian microenvironment of PCOS, chronic inflammation or hormonal imbalance may attenuate HO1 expression through non-NRF2-mediated pathways, including nuclear factor κB (NF-κB) or signal transducer and activator of transcription 3 (STAT3) signaling. This distinctive gene expression pattern suggests an incomplete or dysregulated activation of the NRF2-ARE signaling pathway in PCOS, potentially driven by chronic inflammation, metabolic stress, or hormonal imbalance. The upregulation of KEAP1, a negative regulator of NRF2, further points to feedback inhibition that could limit full antioxidant activation. Taken together, these results indicate a maladaptive redox regulatory system in PCOS, which may contribute to GC dysfunction, impaired oocyte maturation, and subfertility. Recognition of this imbalance highlights potential therapeutic opportunities aimed at restoring redox homeostasis. Moreover, evidence suggests that HO1 may be selectively silenced via promoter methylation under pathological conditions. These findings suggest that the antioxidant response in PCOS is not uniformly elevated but is instead differentially regulated, with impairment of cytoprotective elements such as HO1.

Figure 2.

The expression of the (A) kelch like ECH associated protein 1 (KEAP1), (B) nuclear factor erythroid-2-related factor 2 (NRF2), (C) superoxide dismutase 1 (SOD1), (D) thioredoxin (TXN), (E) peroxiredoxin 1 (PRDX1), and (F) heme oxygenase 1 (HO1) genes in granulosa cell samples of control and polycystic ovary syndrome (PCOS) groups. The values represent the means and standard deviations of comparative real-time polymerase chain reaction results obtained from studied samples. a)p<0.05; b)p<0.001.

In addition, concentrations of TAC and NO in FF were analyzed. As summarized in Table 3, TAC levels were significantly decreased, while NO activity was increased in the PCOS group. Related studies support these findings. For instance, GCs collected from 120 cow ovaries demonstrated that NRF2-ARE pathway activation is crucial for the production of antioxidant enzymes, with NRF2 orchestrating the response [11]. Another investigation involving blood samples from 60 women with PCOS and 90 healthy controls showed significantly lower TAC levels in the PCOS group [20]. Antioxidant genes (PRDX1, SOD1, TXN, KEAP1, HO1, and NRF2) were selected due to their critical role in the NRF2-ARE pathway [12,15], which plays a vital role in combating OS in GCs of mice, cattle, and humans [15,18].

During follicle rupture and ovulation, neutrophils and macrophages release high levels of ROS [7]. Because GCs are particularly vulnerable to OS, the absence of a protective mechanism can trigger multiple cellular dysfunctions that compromise fertility [8]. An effective antioxidant defense in GCs is therefore essential for preventing apoptosis, oxidative injury, and follicular atresia. These cells possess a complex antioxidant system that maintains oocyte homeostasis [9]. Among the endogenous defenses, the NRF2-ARE pathway is especially important in GCs [11,12]. NRF2 serves as a master transcription factor regulating the expression of numerous antioxidant genes, thereby functioning as the principal cellular defense against OS [12]. Under basal conditions, KEAP1 binds to NRF2, sequestering it in the cytoplasm and preventing its nuclear translocation [11]. However, OS leads to modification of cysteine residues in KEAP1, releasing NRF2 and allowing it to translocate to the nucleus, where it binds the ARE promoter sequence [13]. This binding activates downstream genes encoding antioxidant enzymes such as SOD and catalase, which constitute critical first-line defenses against ROS [14].

The upregulation of antioxidant genes in this study likely represents a compensatory response to ROS accumulation, consistent with the observed reduction in TAC (Table 3). Such alterations reflect attempts to neutralize oxidative damage and maintain homeostasis. Nevertheless, OS can simultaneously promote the induction and suppression of different antioxidant genes, depending on the signaling context and severity of imbalance [21]. To deepen understanding of the role of OS in PCOS, biomarkers such as NO (a marker of oxidative activity) and TAC (an indicator of antioxidant capacity) provide useful tools for monitoring redox imbalance. These biomarkers are valuable not only for assessing oxidative injury and disease risk but also for guiding preventive and therapeutic strategies against OS-related conditions [22].

Although the precise effects of follicular fluid oxidative stress on oocyte maturation, fertilization, and pregnancy outcomes remain uncertain, emerging evidence suggests potential associations between variations in FF oxidative biomarkers and assisted reproductive technology success. The elevated NO levels and decreased TAC observed in polycystic ovary syndrome (PCOS) patients may contribute to, or mirror, the oxidative burden experienced by GCs. Reactive oxygen and nitrogen species in the follicular microenvironment can alter GC gene expression through redox-sensitive signaling cascades, including mitogen-activated protein kinase (MAPK), JNK, and NRF2, leading to the upregulation of antioxidant defenses. Alternatively, these biomarker changes and gene expression alterations may represent parallel consequences of systemic PCOS-related dysfunctions, such as inflammation, insulin resistance, or hormonal imbalance. Thus, while the FF environment likely modulates local GC responses, both datasets together illustrate the broader oxidative and regulatory disturbances in PCOS ovaries [23].

In conclusion, this study demonstrates a significant association between the expression of antioxidant genes (PRDX1, SOD1, TXN, KEAP1, HO1, and NRF2) in GCs and PCOS, along with marked differences in FF TAC and NO levels between PCOS patients and controls. These findings support the hypothesis that OS contributes to the development and progression of PCOS, providing new perspectives on its pathogenesis. Further investigation is needed to evaluate the impact of FF TAC on outcomes of ICSI in women with PCOS and other infertility conditions. A key limitation of this study is its reliance solely on mRNA expression data without validation at the protein level. Post-transcriptional and post-translational events—such as NRF2 phosphorylation, nuclear translocation, and KEAP1 ubiquitination—play essential roles in determining functional activity of the NRF2-KEAP1 pathway. Thus, transcript-level data alone may not fully capture the biological output of these molecules. Future studies using protein-based assays, including Western blotting and subcellular localization analyses, are necessary to confirm the transcriptional findings and to clarify the functional status of antioxidant signaling in GCs of PCOS patients.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

The authors would like to thank all participants for their cooperation. We also thank the Deputy of Research and Technology, Ministry of Health and Medical Education of Iran for research grant support.

Author contributions

Conceptualization: MMM, ESH, HN, HHK. Methodology: MMM, ESH, HN, HHK. Formal analysis: HN, HHK. Data curation: TZB, HHK. Funding acquisition: MMM, ESH. Project administration: HN. Visualization: TZB, HHK. Software: HHK. Validation: MMM, LH. Investigation: TZB, HHK. Supervision: HN. Writing-original draft: HN, HHK. Writing-review & editing: MMM, LH. Approval of final manuscript: MMM, ESH, HN, TZB, LH, HHK.

References

1. Deshpande PS, Gupta AS. Causes and prevalence of factors causing infertility in a public health facility. J Hum Reprod Sci 2019;12:287–93. 10.4103/jhrs.jhrs_140_18. 32038077.
2. Massarotti C, Gentile G, Ferreccio C, Scaruffi P, Remorgida V, Anserini P. Impact of infertility and infertility treatments on quality of life and levels of anxiety and depression in women undergoing in vitro fertilization. Gynecol Endocrinol 2019;35:485–9. 10.1080/09513590.2018.1540575. 30612477.
3. Carson SA, Kallen AN. Diagnosis and management of infertility: a review. JAMA 2021;326:65–76. 10.1001/jama.2021.4788. 34228062.
4. Castiglione Morelli MA, Iuliano A, Schettini SC, Petruzzi D, Ferri A, Colucci P, et al. NMR metabolic profiling of follicular fluid for investigating the different causes of female infertility: a pilot study. Metabolomics 2019;15:19. 30830455.
5. Choe J, Shanks AL. In vitro fertilization. In: Statpearls StatPearls Publishing; 2023. [cited 2025 Nov 8]. Available from: https://www.ncbi.nlm.nih.gov/books/NBK562266.
6. Dong L, Xin X, Chang HM, Leung PC, Yu C, Lian F, et al. Expression of long noncoding RNAs in the ovarian granulosa cells of women with diminished ovarian reserve using high-throughput sequencing. J Ovarian Res 2022;15:119. 10.1186/s13048-022-01053-6. 36309699.
7. Agarwal A, Aponte-Mellado A, Premkumar BJ, Shaman A, Gupta S. The effects of oxidative stress on female reproduction: a review. Reprod Biol Endocrinol 2012;10:49. 10.1186/1477-7827-10-49. 22748101.
8. Lai Q, Xiang W, Li Q, Zhang H, Li Y, Zhu G, et al. Oxidative stress in granulosa cells contributes to poor oocyte quality and IVF-ET outcomes in women with polycystic ovary syndrome. Front Med 2018;12:518–24. 10.1007/s11684-017-0575-y. 29260383.
9. Yang H, Xie Y, Yang D, Ren D. Oxidative stress-induced apoptosis in granulosa cells involves JNK, p53 and Puma. Oncotarget 2017;8:25310–22. 10.18632/oncotarget.15813. 28445976.
10. Wang S, He G, Chen M, Zuo T, Xu W, Liu X. The role of antioxidant enzymes in the ovaries. Oxid Med Cell Longev 2017;2017:4371714. 10.1155/2017/4371714. 29147461.
11. Sohel MM, Amin A, Prastowo S, Linares-Otoya L, Hoelker M, Schellander K, et al. Sulforaphane protects granulosa cells against oxidative stress via activation of NRF2-ARE pathway. Cell Tissue Res 2018;374:629–41. 10.1007/s00441-018-2877-z. 30032437.
12. Akino N, Wada-Hiraike O, Terao H, Honjoh H, Isono W, Fu H, et al. Activation of Nrf2 might reduce oxidative stress in human granulosa cells. Mol Cell Endocrinol 2018;470:96–104. 10.1016/j.mce.2017.10.002. 28986302.
13. Poljsak B, Suput D, Milisav I. Achieving the balance between ROS and antioxidants: when to use the synthetic antioxidants. Oxid Med Cell Longev 2013;2013:956792. 10.1155/2013/956792. 23738047.
14. Awad MA, Aldosari SR, Abid MR. Genetic alterations in oxidant and anti-oxidant enzymes in the vascular system. Front Cardiovasc Med 2018;5:107. 10.3389/fcvm.2018.00107. 30140678.
15. Khadrawy O, Gebremedhn S, Salilew-Wondim D, Taqi MO, Neuhoff C, Tholen E, et al. Endogenous and exogenous modulation of Nrf2 mediated oxidative stress response in bovine granulosa cells: potential implication for ovarian function. Int J Mol Sci 2019;20:1635. 10.3390/ijms20071635. 30986945.
16. Hagemann LJ. Influence of the dominant follicle on oocytes from subordinate follicles. Theriogenology 1999;51:449–59. 10.1016/s0093-691x(98)00239-8. 10729104.
17. Yang HW, Hwang KJ, Kwon HC, Kim HS, Choi KW, Oh KS. Detection of reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Hum Reprod 1998;13:998–1002. 10.1093/humrep/13.4.998. 9619561.
18. Pasqualotto EB, Agarwal A, Sharma RK, Izzo VM, Pinotti JA, Joshi NJ, et al. Effect of oxidative stress in follicular fluid on the outcome of assisted reproductive procedures. Fertil Steril 2004;81:973–6. 10.1016/j.fertnstert.2003.11.021. 15066450.
19. Dutta S, Sengupta P. The role of nitric oxide on male and female reproduction. Malays J Med Sci 2022;29:18–30.
20. Kanafchian M, Esmaeilzadeh S, Mahjoub S, Rahsepar M, Ghasemi M. Status of serum copper, magnesium, and total antioxidant capacity in patients with polycystic ovary syndrome. Biol Trace Elem Res 2020;193:111–7. 10.1007/s12011-019-01705-7. 30941676.
21. Dalton TP, Shertzer HG, Puga A. Regulation of gene expression by reactive oxygen. Annu Rev Pharmacol Toxicol 1999;39:67–101. 10.1146/annurev.pharmtox.39.1.67. 10331077.
22. Dib M, Garrel C, Favier A, Robin V, Desnuelle C. Can malondialdehyde be used as a biological marker of progression in neurodegenerative disease? J Neurol 2002;249:367–74. 10.1007/s004150200025. 11967639.
23. Gongadashetti K, Gupta P, Dada R, Malhotra N. Follicular fluid oxidative stress biomarkers and ART outcomes in PCOS women undergoing in vitro fertilization: a cross-sectional study. Int J Reprod Biomed 2021;19:449–56. 10.18502/ijrm.v19i5.9254. 34278198.

Article information Continued

Figure 1.

Antioxidant activity in the follicular fluid of the polycystic ovary syndrome (PCOS) and control groups. (A) The left scale plots nitric oxide (NO) values, whereas (B) the right scale shows total antioxidant capacity (TAC). Bars represent standard deviation. a)p<0.05; b)p<0.001.

Figure 2.

The expression of the (A) kelch like ECH associated protein 1 (KEAP1), (B) nuclear factor erythroid-2-related factor 2 (NRF2), (C) superoxide dismutase 1 (SOD1), (D) thioredoxin (TXN), (E) peroxiredoxin 1 (PRDX1), and (F) heme oxygenase 1 (HO1) genes in granulosa cell samples of control and polycystic ovary syndrome (PCOS) groups. The values represent the means and standard deviations of comparative real-time polymerase chain reaction results obtained from studied samples. a)p<0.05; b)p<0.001.

Table 1.

Primer sequences for quantitative real-time polymerase chain reaction

Gene Primer name 5'–3' Oligonucleotide
HO1 HO1-F ATGACACCAAGGACCAGAGC
HO1-R GTGTAAGGACCCATCGGAGA
PRDX1 PRDX1-F AGCCTGTCTGACTACAAAGGA
PRDX1-R TTCTTCTGCCCTATCACTGAAA
SOD1 SOD1-F TGAAGGTGTGGGGAAGCATT
SOD1-R CCACCTTTGCCCAAGTCATC
TXN TXN-F AGGGACAAAAGGTGGGTGAA
TXN-R ATTGTCACGCAGATGGCAAC
NRF2 NRF2-F TTCCCGGTCACATCGAGAG
NRF2-R TCCTGTTGCATACCGTCTAAATC
KEAP1 KEAP1-F CTGGAGGATCATACCAAGCAGG
KEAP1-R GGATACCCTCAATGGACACCAC
GAPDH GAPDH-F GAGTCAACGGATTTGGTCGT
GAPDH-R TTGATTTTGGAGGGATCTCG

HO1, heme oxygenase 1; PRDX1, peroxiredoxin 1; SOD1, superoxide dismutase 1; TXN, thioredoxin; NRF2, nuclear factor erythroid-2-related factor 2; KEAP1, kelch like ECH associated protein 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Table 2.

Means and standard deviations of gene expression in the PCOS and control groups

Gene PCOS (n=28) Control (n=18) p-value
HO1 (gene fold) 1.228 2.783 0.0259a)
PRDX1 (gene fold) 2.387 1.280 0.0196a)
SOD1 (gene fold) 2.400 1.371 0.0418a)
TXN (gene fold) 2.577 0.9248 0.0001b)
NRF2 (gene fold) 1.224 0.7018 0.0430a)
KEAP1 (gene fold) 1.583 0.8475 0.0310a)

PCOS, polycystic ovary syndrome; HO1, heme oxygenase 1; PRDX1, peroxiredoxin 1; SOD1, superoxide dismutase 1; TXN, thioredoxin; NRF2, nuclear factor erythroid-2-related factor 2; KEAP1, kelch like ECH associated protein 1.

a)

p<0.05;

b)

p<0.001.

Table 3.

Means and standard deviation of NO and TAC activity in the FF for the patient and control groups

Markers in FF PCOS (n=28) Control (n=18) p-value
NO (μM) 90.40 61.57 0.0222a)
TAC (μM) 692.1 1256 0.0005b)

NO, nitric oxide; TAC, total antioxidant capacity; FF, follicular fluid; PCOS, polycystic ovary syndrome.

a)

p<0.05;

b)

p<0.001.