Korean J Fertil Steril Search

CLOSE


Clin Exp Reprod Med > Epub ahead of print
Hejazi, Javazmi, and Bagheri: Umbelliferone protects testes and spermatogenesis against lead acetate by effectively mitigating oxidative stress, inflammation, and apoptosis

Abstract

Objective

Lead acetate exposure induces male reproductive toxicity through oxidative stress and inflammation, impairing spermatogenesis and testosterone production. Umbelliferone (UMB), a coumarin derivative with antioxidant and anti-inflammatory properties, may counteract these adverse effects. This study evaluated the protective effects of UMB on lead acetate-induced testicular toxicity in male Wistar rats, with a focus on sperm parameters, antioxidant status, inflammatory markers, and testicular histology.

Methods

Thirty-two male Wistar rats were assigned to four groups (n=8 each): control (saline), lead (50 mg/kg lead acetate [intraperitoneal], lead+UMB (25 mg/kg), and lead+UMB (50 mg/kg). Treatments were administered daily for 21 days. Sperm parameters (count, motility, viability, morphology) were assessed, alongside measurements of antioxidant enzyme levels (superoxide dismutase, catalase, glutathione), malondialdehyde (MDA), serum testosterone, and mRNA expression of tumor necrosis factor-α, interleukin-6 (IL-6), transforming growth factor-β, IL-10, Bcl-2-associated X protein (Bax), and B-cell lymphoma-2 (Bcl-2). Testicular histology was evaluated using hematoxylin and eosin staining.

Results

Lead exposure significantly reduced sperm quality, antioxidant enzyme levels, testosterone, and Bcl-2 expression, while increasing MDA, pro-inflammatory cytokines, and Bax expression (p<0.05). UMB (25 and 50 mg/kg) markedly improved sperm parameters, restored antioxidant levels, reduced MDA and inflammatory markers, increased testosterone and Bcl-2, and decreased Bax expression (p<0.01). Histological analysis demonstrated that UMB preserved testicular architecture. No significant differences were observed between the two UMB doses (p>0.05).

Conclusion

UMB effectively mitigates lead-induced testicular toxicity by reducing oxidative stress, inflammation, and apoptosis, while improving sperm quality and testosterone levels. These findings suggest its potential as a therapeutic agent.

Introduction

Lead acetate, a common environmental toxicant, has been extensively studied for its detrimental effects on the male reproductive system [1]. Exposure to lead impairs spermatogenesis, reduces sperm quality, and causes testicular damage, primarily through mechanisms involving oxidative stress and inflammation [2]. These processes disrupt cellular homeostasis, leading to lipid peroxidation, DNA damage, and apoptosis in testicular tissues, which ultimately impair testosterone production and spermatogenesis [3]. Additionally, lead activates pro-inflammatory pathways, such as nuclear factor-kappa B (NF-κB), which increase the production of cytokines like tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), resulting in immune cell infiltration, tissue injury, and germ cell loss [2]. Natural compounds with antioxidant and anti-inflammatory properties have therefore garnered attention as potential protective agents against lead-induced toxicity [4].
Umbelliferone (UMB), a naturally occurring coumarin derivative found in plants of the Apiaceae family, has emerged as a promising candidate due to its well-established pharmacological activities [5]. It exhibits strong antioxidant, anti-inflammatory, and anti-apoptotic effects, making it an attractive agent for mitigating lead-induced reproductive toxicity [5]. UMB counteracts these harmful effects by scavenging free radicals, enhancing endogenous antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), and glutathione (GSH) peroxidase, and inhibiting key inflammatory pathways, which results in reduced expression of pro-inflammatory cytokines and enzymes such as cyclooxygenase-2 [6].
Oxidative stress plays a central role in lead acetate-induced testicular toxicity by disrupting mitochondrial function, leading to excessive reactive oxygen species (ROS) production and depletion of antioxidant defenses, including reduced GSH [7]. This process results in increased malondialdehyde (MDA), a marker of lipid peroxidation [8]. Studies suggest that UMB mitigates these effects by directly neutralizing ROS and activating the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway, which increases antioxidant gene transcription, restores GSH levels, and lowers MDA concentrations [9].
Furthermore, UMB’s anti-inflammatory actions involve suppression of NF-κB activation, likely through inhibition of upstream kinases such as IκB kinase (IKK), resulting in reduced production of TNF-α, IL-6, and inducible nitric oxide synthase. This alleviates acute inflammatory responses and prevents chronic testicular damage that could compromise fertility [10]. By modulating both oxidative stress and inflammation, UMB preserves testicular architecture, maintains seminiferous tubule integrity, and improves sperm parameters in lead-exposed subjects [11].
This study investigated the protective effects of UMB on testes and spermatogenesis in the context of lead acetate toxicity, emphasizing its ability to counteract oxidative stress and inflammation. Elucidating these protective mechanisms may provide new insights into therapeutic strategies for mitigating lead-induced reproductive toxicity and enhancing male fertility.

Methods

1. Animals

Thirty-two male Wistar rats, each weighing between 200 and 250 g, were obtained from the animal facility at Shahid Sadoughi University of Medical Sciences in Yazd, Iran. The rats were housed in plastic cages within an air-controlled environment maintained at 26±2°C, with a 12-hour light/dark cycle. They had free access to tap water and were provided standard rat chow ad libitum. The study protocol was approved by the Ethical Committee for Preclinical Research and Animal Care at Shahid Sadoughi University of Medical Sciences (approval no. ssu.164.253.26).

2. Experimental design

The 32 male Wistar rats were randomly assigned to four groups, each comprising eight animals. The control group received daily oral gavage with normal saline. The lead group was administered 50 mg/kg of lead acetate intraperitoneally (i.p.) each day. This dose of lead acetate (50 mg/kg) was selected based on previous studies demonstrating its ability to induce significant reproductive toxicity in male Wistar rats without causing systemic toxicity [12]. The third group, referred to as the lead+UMB (25 mg/kg) group, received a combination of 50 mg/kg lead acetate i.p. daily and 25 mg/kg of UMB administered orally. The fourth group, designated as the lead+UMB (50 mg/kg) group, was treated with 50 mg/kg lead acetate i.p. daily and 50 mg/kg of UMB orally. All treatments were administered consistently over a period of 21 days. At the end of the experimental period, the rats were euthanized by diethyl ether inhalation, and their epididymides were excised for subsequent sperm analysis.

3. Sperm analysis

Sperm counts were conducted by placing approximately 10 μL of diluted sperm suspension onto a Meckler slide, allowing it to settle for 5 minutes, and examining it under a binocular light microscope. The proportions of progressive, non-progressive, and immotile sperm were calculated. Sperm viability was assessed using eosin staining, wherein a drop of diluted semen was mixed with two drops of eosin solution. Viable sperm, which do not take up the stain, were distinguished from non-viable sperm, which do. Sperm morphology was evaluated via Giemsa staining, and the percentage of normal sperm was determined by randomly counting 100 sperm cells.

4. Histopathological examination

The left testes were preserved in 10% neutral buffered formalin, embedded in paraffin, and sectioned into 5-μm slices. These sections were stained with hematoxylin and eosin and examined under a light microscope (Olympus) for histopathological evaluation.

5. Measurement of antioxidant enzymes

Oxidative stress biomarkers, including GSH, SOD, and MDA, were measured using specialized commercial kits according to the manufacturer’s instructions. CAT activity was determined using a commercial ultraviolet spectroscopic method. A mixture of 10 μL testis homogenate supernatant and 0.5 mL of 10 mM hydrogen peroxide (H₂O₂) was analyzed for changes in optical density at 240 nm with a spectrophotometer. A decrease in optical density over three minutes was indicative of CAT activity.

6. Hormonal assay

Serum testosterone levels were measured using an enzyme-linked immunosorbent assay (ELISA) with a commercial kit (AccuBind ELISA kit; Monobind Inc.), following the manufacturer’s instructions.

7. Reverse transcription and real-time polymerase chain reaction

Right testis tissues were immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction. Total RNA was extracted using RNX-Plus solution at the Central Research Laboratory of Shahid Sadoughi University of Medical Sciences, in accordance with the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized from 1 μg of RNA using the Thermo Scientific RevertAid First Strand cDNA Synthesis Kit. The cDNA was amplified by reverse transcription polymerase chain reaction (PCR) with AmpliTaq Gold DNA polymerase and quantified by real-time PCR using Premix Ex Taq mix and SYBR Green I dye on a Step One Plus system. Primers, supplied by Betagen Inc., are listed in Table 1. Relative mRNA expression levels were calculated using the 2−ΔΔCt method, with β-actin as the reference gene for normalization. All samples were analyzed in duplicate, and mean cycle threshold (Ct) values were used to determine fold changes relative to the control group.

8. Statistical analysis

Data are presented as mean±standard error of the mean. Differences between groups were analyzed using one-way analysis of variance (ANOVA) followed by the Tukey-Kramer post hoc test. Statistical analyses were conducted using GraphPad Prism version 9 (GraphPad Inc.).

Results

1. Effects of UMB on sperm parameters

Sperm analysis results are presented in Table 2. The lead-treated group showed significant reductions in sperm count, motility, morphology, and viability compared to the control group. In contrast, both lead+UMB groups (25 and 50 mg/kg) demonstrated significant improvements in all sperm parameters (p<0.05). Post hoc analysis revealed no statistically significant differences between the 25 and 50 mg/kg UMB groups for any sperm parameter (p>0.05), suggesting that the lower dose may be sufficient to confer protective effects. Total motility (%) in the lead group (47%±4.2%) was not significantly different from the control group (54%±6.3%) (p>0.05), indicating that lead exposure primarily affects specific motility parameters rather than overall motility. Both UMB doses restored motility parameters to levels comparable to the control group (p<0.05).

2. Antioxidant parameters

In the lead group, levels of SOD, GSH, and CAT were significantly reduced, while MDA levels, indicative of lipid peroxidation, were elevated relative to the control group. Treatment with UMB (25 and 50 mg/kg) in combination with lead significantly decreased MDA levels and increased SOD, GSH, and CAT levels compared to the lead group (p<0.01) (Figure 1). No statistically significant differences were found between the 25 and 50 mg/kg UMB groups for antioxidant enzyme levels (p>0.05).

3. mRNA expression of TNF-α, TGF-β, IL-6, IL-10, Bcl2, and Bax

Gene expression analysis showed significant upregulation of TNF-α, transforming growth factor-beta (TGF-β), IL-6, and IL-10 in the lead group compared to the control group. In contrast, the UMB treatment groups exhibited significant reductions in the expression of these cytokine genes compared to the lead group (p<0.01) (Figure 2). There were no statistically significant differences between the 25 and 50 mg/kg UMB groups regarding cytokine expression (p>0.05). The expression of apoptotic genes also revealed that B-cell lymphoma-2 (Bcl-2) levels in the lead group were significantly decreased compared to control, while treatment with UMB significantly increased Bcl-2 expression (p<0.01) (Figure 3). Again, no significant differences were observed between the two UMB treatment groups. Conversely, Bcl-2-associated X protein (Bax) gene expression was elevated in the lead group relative to control and was significantly reduced in both treatment groups (p<0.01) (Figure 3), with no significant difference between the two doses.

4. Serum testosterone levels

As shown in Figure 4, serum testosterone levels were significantly lower in the lead group compared to the control group (p<0.05). Treatment with UMB (25 and 50 mg/kg) resulted in a significant increase in testosterone levels compared to the lead group (p<0.05).

5. Histopathological findings

The control group displayed normal testicular histology, with intact seminiferous tubules (Figure 5A). In contrast, the lead group exhibited marked abnormalities, including reduced epithelial height, testicular degeneration, intertubular edema, thickened basal membranes, decreased numbers of germ cells, and the presence of vacuolated cells (Figure 5B). In the UMB-treated groups (25 and 50 mg/kg), these histopathological changes were markedly alleviated, with reduced degeneration, increased epithelial height, and diminished interstitial edema observed compared to the lead group (Figure 5C, 5D).

Discussion

The present study demonstrates that UMB significantly ameliorates lead acetate-induced testicular toxicity by improving sperm parameters, enhancing antioxidant enzyme activity, modulating inflammatory cytokine expression, and restoring testosterone levels. Lead acetate exposure is well-documented for its detrimental effects on male reproductive health, primarily through oxidative stress and inflammation that disrupt spermatogenesis and testicular function [13]. Our findings are consistent with previous studies indicating that lead induces oxidative damage, lipid peroxidation, and inflammatory responses in the testes, resulting in compromised fertility [14]. Lead exposure in this study led to significant reductions in sperm count, motility, viability, and normal morphology, corroborating earlier reports that lead disrupts spermatogenesis by inducing germ cell apoptosis and impairing epididymal function [15]. The administration of UMB at both 25 and 50 mg/kg doses resulted in marked improvements in all assessed sperm parameters, suggesting that UMB enhances sperm quality, likely through its potent antioxidant properties that counteract lead-induced oxidative damage in the reproductive tract.
Oxidative stress is a central mechanism of lead-induced testicular damage, as evidenced by reduced levels of key antioxidant enzymes (SOD, CAT, and GSH) and elevated MDA levels in the lead-treated group [16]. The depletion of antioxidant enzymes is a hallmark of lead toxicity, exacerbating ROS accumulation, which in turn leads to lipid peroxidation and cellular damage [17]. In this study, UMB treatment significantly increased SOD, CAT, and GSH levels while reducing MDA concentrations, highlighting a strong protective role in maintaining redox homeostasis. These findings are consistent with prior studies that describe UMB's capacity to activate the Nrf2 signaling pathway, which regulates the expression of antioxidant defense genes [17].
Lead acetate exposure also upregulated the expression of pro-inflammatory cytokines TNF-α, IL-6, and TGF-β, all of which contribute to testicular inflammation and tissue damage. The significant reduction of these cytokines in the UMB-treated groups suggests that its protective effects are mediated, at least in part, by inhibition of inflammatory pathways [18]. UMB’s protective effect against lead acetate toxicity also extends to apoptosis. The present results showed that lead exposure decreases the expression of the anti-apoptotic gene Bcl-2 and increases the pro-apoptotic gene Bax (p<0.01), shifting the Bax/Bcl-2 ratio toward apoptosis. Treatment with UMB significantly increased Bcl-2 expression and decreased Bax expression (p<0.01), restoring the balance toward cell survival. Regarding apoptosis, Wang et al. [19] demonstrated that lead increases Bax and decreases Bcl-2 expression, thereby inducing apoptosis in fibroblast cells, consistent with the current findings. Zhang et al. [20] reported that UMB reduces the Bax/Bcl-2 ratio, inhibiting oxidative stress-induced apoptosis in liver cells, which is in agreement with our results. Wu et al. [21] further noted that UMB exerts anti-apoptotic effects through mitochondrial pathways, supporting its protective role against lead toxicity.
The observed downregulation of inflammatory mediators may be attributed to the suppression of NF-κB activation, likely via inhibition of upstream kinases such as IKK [22]. Previous studies have demonstrated that UMB possesses potent anti-inflammatory activity by inhibiting NF-κB signaling and reducing cytokine production, which supports our observations [10]. Lead toxicity is known to disrupt the hypothalamic-pituitary-gonadal axis, resulting in decreased testosterone production, as observed in the lead-treated group. Testosterone is essential for spermatogenesis, and its reduction is closely associated with impaired testicular function [23]. UMB administration significantly increased serum testosterone levels compared to the lead group, suggesting a role in preserving Leydig cell function. The reduction in oxidative stress and inflammation likely contributes to the maintenance of steroidogenesis, as ROS and pro-inflammatory cytokines are known to impair testosterone biosynthesis by damaging Leydig cells [24].
Histological analysis revealed severe testicular damage in lead-exposed rats, characterized by reduced epithelial height, germ cell depletion, intertubular edema, and vacuolated cells. These results are consistent with reports that lead acetate disrupts testicular architecture, leading to apoptosis and impaired spermatogenesis [25]. Importantly, UMB treatment mitigated these histopathological changes, preserving seminiferous tubule integrity and reducing cellular degeneration. The protective effects on testicular tissue further support the role of UMB in maintaining reproductive function under toxic conditions.
The findings of this study indicate that UMB effectively mitigates lead acetate-induced testicular toxicity by reducing oxidative stress, suppressing inflammatory responses, improving sperm quality, and restoring testosterone levels. These results highlight its potential as a therapeutic agent for lead-induced male reproductive toxicity. However, although UMB exhibited significant protective effects, potential off-target effects or toxicity at higher doses were not evaluated in this study. Additionally, the safety profile of UMB with chronic administration remains to be established. Future studies should include toxicological assessments and pharmacokinetic analyses to ensure its safety for clinical applications.
In conclusion, the findings of this study demonstrate that UMB effectively counteracts lead acetate-induced testicular toxicity in male Wistar rats. By alleviating oxidative stress, UMB significantly enhances antioxidant enzyme levels (SOD, CAT, and GSH) and reduces lipid peroxidation (MDA). It also suppresses inflammatory responses by downregulating pro-inflammatory cytokines (TNF-α, IL-6, TGF-β) and modulating apoptotic gene expression (Bcl-2 and Bax), thereby preventing germ cell loss. Additionally, UMB restores serum testosterone levels and improves sperm parameters—including count, motility, viability, and morphology—while preserving testicular architecture. Notably, both 25 and 50 mg/kg doses of UMB exhibited comparable protective effects, suggesting that the lower dose may be sufficient for therapeutic benefits. These results highlight UMB’s potential as a promising natural compound for mitigating lead-induced reproductive toxicity and offer insights into its therapeutic application for protecting male fertility. Future research should focus on long-term safety, pharmacokinetic profiles, and potential clinical translation to further validate UMB’s efficacy.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

We are also grateful to the staff of Yazd Neuroendocrine Research Center, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran for their efforts.

Author contributions

Conceptualization: SMB. Methodology: MH. Formal analysis: MH. Data curation: RFJ. Funding acquisition: RFJ. Project administration: SMB. Validation: MH. Investigation: RFJ. Writing-original draft: SMB. Writing-review & editing: MH. Approval of final manuscript: MH, RFJ, SMB.

Figure 1.
(A) Malondialdehyde (MDA), (B) glutathione (GSH), (C) superoxide dismutase (SOD), and (D) catalase (CAT) levels in the different study groups. Data are presented as mean±standard error of the mean. UMB, umbelliferone. a)p<0.01 compared to the lead group; b)p<0.01 compared to the control group.
cerm-2025-08256f1.jpg
Figure 2.
Expression levels of (A) tumor necrosis factor-alpha (TNF-α), (B) transforming growth factor-beta (TGF-β), (C) interleukin-6 (IL-6), and (D) interleukin-10 (IL-10) genes determined by reverse transcription polymerase chain reaction in the different study groups. Data are expressed as mean±standard error of the mean (n=8 per group). UMB, umbelliferone. a)p<0.05, b)p<0.01 compared to the lead group; c)p<0.05, d)p<0.01 compared to the control group.
cerm-2025-08256f2.jpg
Figure 3.
Expression levels of (A) B-cell lymphoma 2 (Bcl-2) and (B) Bcl-2-associated X protein (Bax) genes determined by reverse transcription polymerase chain reaction in the different study groups. Data are expressed as mean±standard error of the mean (n=8 per group). UMB, umbelliferone. a)p<0.01 compared to the lead group; b)p<0.01 compared to the control group.
cerm-2025-08256f3.jpg
Figure 4.
Serum testosterone concentrations in the different groups. Data are presented as mean±standard error of the mean. UMB, umbelliferone. a)p<0.01 compared to the lead group; b)p<0.01 compared to the control group.
cerm-2025-08256f4.jpg
Figure 5.
Histological examination of the testis in the different groups (hematoxylin and eosin, ×100). The control group (A) exhibited a normal histological structure of the seminiferous tubules, with no histopathological changes observed. The lead-treated group (B) showed a decrease in the epithelial height of the seminiferous tubules, testicular degeneration, and intratubular edema. In the umbelliferone-treated groups (C, D), testicular sections appeared largely normal, similar to the control group, with only mild testicular degeneration observed.
cerm-2025-08256f5.jpg
Table 1.
Primers used for reverse transcription polymerase chain reaction analysis
No Gene Forward primer Reverse primer
1 β-Actin 5′‐CGCGAGTACAACCTTCTTGC‐3′ 5′GTCTACAACATGATCTGGGTCA3′
2 TGF-β 5′‐GCAACAATTCCTGGCGTTAC‐3′ 5′‐GTATTCCGTCTCCTTGGTTCAG‐3ʹ
3 TNF-α 5′-GTCGTAGCAAACCACCAAGC‐3′ 5′-CTCCTGGTATGAAATGGCAAA‐3′
4 IL-6 5′-CCTTCCTACCCCAACTTCCA‐3′ 5′-AGCACACTAGGTTTGCCGAG‐3′
5 IL-10 5′-CTTTCACTTGCCCTCATCC‐3′ 5′-ACAAACAATACGCCATTCCC‐3′
6 BAX 5′-GGCGAATTGGCGATGAACTG‐3′ 5′-ATGGTTCTGATCAGCTCGGG‐3′
7 BCL-2 5′-TCCTGCATCTCATGCCAAGG‐3′ 5′-ATCCTTCCGGGGAAAGAAGC‐3′

TGF-β, transforming growth factor-beta; TNF-α, tumor necrosis factor-alpha; IL-6, interleukin-6; IL-10, interleukin-10; BAX, Bcl-2-associated X protein; BCL-2, B-cell lymphoma 2.

Table 2.
Results of semen analysis in the different study groups
Variable Control Lead Lead+UMB 25 Lead+UMB 50
Count (×106) 8.3±0.8 5.2±1.1b) 6.7±0.8a) 7.5±0.6a)
Rapid motility (%) 24±2.8 10±1.6b) 22±2.3a) 19±2.4a)
Slow motility (%) 10±1.2 11±2.6b) 12±1.5 14±1.6a)
Non-progressive motility (%) 20±1.9 26±2.9b) 19±2.5a) 22±2.8a)
Immotile sperm (%) 46±4.3 53±5.8b) 48±4.1a) 45±3.7a)
Total motility (%) 54±6.3 47±4.2b) 52±4.8a) 55±6.3a)
Normal morphology (%) 83.6±8.9 51.2±5.2.2b) 70.3±9.3a) 75.7±7.9a)
Viability (%) 86±8.2 61±6.5b) 71±7.2a) 75±8.6a)

Values are presented as mean±standard deviation.

UMB, umbelliferone.

a)p<0.05 Significant difference between treated groups with lead group;

b)p<0.05 Significant difference between lead with control group (n=8 in each group).

References

1. Besong EE, Ashonibare PJ, Akhigbe TM, Obimma JN, Akhigbe RE. Sodium acetate abates lead-induced sexual dysfunction by upregulating testosterone-dependent eNOS/NO/cGMP signaling and activating Nrf2/HO-1 in male Wistar rat. Naunyn Schmiedebergs Arch Pharmacol 2024;397:1233-43.
crossref pmid pdf
2. Besong EE, Akhigbe TM, Oyedokun PA, Hamed MA, Akhigbe RE. Acetate attenuates lead-induced dysregulation of testicular steroidogenesis and spermatogenesis by targeting oxidative stress, inflammatory cytokines, and apoptosis. Toxicol Res 2024;40:613-26.
crossref pmid pmc pdf
3. Ahmed ASA, Razooqi QA. Evaluation of oxidative indicators and sex parameters for male rats exposed to cadmium chloride and lead acetate. Cent Asian J Med Nat Sci 2025;6:250-61.

4. Badraoui R, Gargouri M, Brahmi F, Ben-Nasr H, Bahrini I, Soussi A, et al. Protective effects of Juglans regia oil on lead acetate-induced reprotoxicity in rats: an antioxidant, histological and computational molecular study. J Sci Food Agric 2025;105:2515-26.
crossref pmid
5. Kim DJ, Jung MS, Jin HU, Kim MS, An CE. Anti-melanogenic effects of umbelliferone: in vitro and clinical studies. Molecules 2024;29:5571.
crossref pmid pmc
6. Leal LE, Moreira ES, Correia BL, Bueno PSA, Comar JF, de Sa-Nakanishi AB, et al. Comparative study of the antioxidant and anti-inflammatory effects of the natural coumarins 1,2-benzopyrone, umbelliferone and esculetin: in silico, in vitro and in vivo analyses. Naunyn Schmiedebergs Arch Pharmacol 2024;397:173-87.
crossref pmid pdf
7. Shalan MG. Mitigating lead acetate-induced histopathologic and physiologic disorders in rats receiving vitamin C and glutathione supplement. Heliyon 2025;11:e41256.
crossref pmid pmc
8. Samarghandian S, Borji A, Afshari R, Delkhosh MB, Gholami A. The effect of lead acetate on oxidative stress and antioxidant status in rat bronchoalveolar lavage fluid and lung tissue. Toxicol Mech Methods 2013;23:432-6.
crossref pmid
9. Mahmoud AM, Germoush MO, Alotaibi MF, Hussein OE. Possible involvement of Nrf2 and PPARγ up-regulation in the protective effect of umbelliferone against cyclophosphamide-induced hepatotoxicity. Biomed Pharmacother 2017;86:297-306.
crossref pmid
10. Wu G, Nie W, Wang Q, Hao Y, Gong S, Zheng Y, et al. Umbelliferone ameliorates complete freund adjuvant-induced arthritis via reduction of NF-κB signaling pathway in osteoclast differentiation. Inflammation 2021;44:1315-29.
crossref pmid pdf
11. Allam MAM, Khowailed AA, Elattar S, Mahmoud AM. Umbelliferone ameliorates oxidative stress and testicular injury, improves steroidogenesis and upregulates peroxisome proliferator-activated receptor gamma in type 2 diabetic rats. J Pharm Pharmacol 2022;74:573-84.
crossref pmid pdf
12. Wurlina W, Mustofa I, Meles DK, Khairullah AR, Akintunde AO, Rachmawati K, et al. Restoration of sperm quality in lead acetate-induced rats via treatment with Moringa oleifera leaf extract. Open Vet J 2025;15:416-27.
crossref pmid pmc
13. Haouas Z, Zidi I, Sallem A, Bhouri R, Ajina T, Zaouali M, et al. Reproductive toxicity of lead acetate in adult male rats: histopathological and cytotoxic studies. J Cytol Histol 2015;6:293.

14. Zhao S, Li Z, Li K, Dai X, Xu Z, Li L, et al. Repairing effect of mesenchymal stem cells on lead acetate-induced testicular injury in mice. Cell Transplant 2024;33:9636897231219395.
crossref pmid pmc pdf
15. Hama amin GS, Hamad KR. Effect of vitamin C against lead acetate toxicity on sperm count, sperm morphology and testis tissue in the rat before and in recovery period. Zanco J Pure Appl Sci 2020;32:127-38.

16. El-Magd MA, Kahilo KA, Nasr NE, Kamal T, Shukry M, Saleh AA, et al. A potential mechanism associated with lead-induced testicular toxicity in rats. Andrologia 2017;49:12750.
crossref pdf
17. Zheng Y, Zhang Q, Jing L, Fei Y, Zhao H. The effects of chronic lead exposure on testicular development of Japanese Quail (Coturnix japonica): histopathological damages, oxidative stress, steroidogenesis disturbance, and hypothalamus-pituitary-testis axis disruption. Biol Trace Elem Res 2023;201:3446-60.
crossref pmid pdf
18. Gan J, Qian W, Lin S. Umbelliferone alleviates myocardial ischemia: the role of inflammation and apoptosis. Inflammation 2018;41:464-73.
crossref pmid pdf
19. Wang L, Xu Y, Zhao X, Zhu X, He X, Sun A, et al. Antagonistic effects of N-acetylcysteine on lead-induced apoptosis and oxidative stress in chicken embryo fibroblast cells. Heliyon 2023;9:e21847.
crossref pmid pmc
20. Zhang S, Zhang S, Li YY, Zhang Y, Wang H, Chen Y, et al. Umbelliferone protects against methylglyoxal-induced HUVECs dysfunction through suppression of apoptosis and oxidative stress. J Appl Toxicol 2023;43:490-9.
crossref pmid pdf
21. Wu Z, Geng Y, Buist-Homan M, Moshage H. Scopoletin and umbelliferone protect hepatocytes against palmitate- and bile acid-induced cell death by reducing endoplasmic reticulum stress and oxidative stress. Toxicol Appl Pharmacol 2022;436:115858.
crossref pmid
22. Li C, Moro S, Shostak K, O'Reilly FJ, Donzeau M, Graziadei A, et al. Molecular mechanism of IKK catalytic dimer docking to NF-κB substrates. Nat Commun 2024;15:7692.
crossref pmid pmc pdf
23. Rojas-Zambrano JG, Rojas-Zambrano AR, Rojas-Zambrano AF, Barahona-Cueva GE. Benefits of testosterone hormone in the human body: a systematic review. Cureus 2025;17:e78785.
crossref pmid pmc
24. Enina TN, Petelina TI, Shirokov NE, Gorbatenko EA, Rodionova AE, Gapon LI. Association of testosterone levels and oxidative stress activity with 10-year survival in men with cardiac resynchronization therapy. J Arrhythm 2024;31:14-27.

25. Khodabandeh Z, Dolati P, Zamiri MJ, Mehrabani D, Bordbar H, Alaee S, et al. Protective effect of quercetin on testis structure and apoptosis against lead acetate toxicity: an stereological study. Biol Trace Elem Res 2021;199:3371-81.
crossref pmid pdf
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  •   Scopus
  • 747 View
  • 13 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next