Clin Exp Reprod Med Search

CLOSE


Clin Exp Reprod Med > Volume 53(2); 2026 > Article
Afshar, Aghajanpour, Fadaefathabadi, Abbaszadeh, Nazarian, Soltani, and Nourozian: Photobiomodulation mitigates phenanthrene-induced testicular toxicity in mice by modulating oxidative stress and apoptosis biomarkers

Abstract

Objective

Organic compounds present in environmental pollution are currently regarded as major health threats. Phenanthrene (Phe), a polycyclic aromatic hydrocarbon, impairs testicular function through oxidative stress, leading to the failure of spermatogenesis. This study aimed to explore the potential beneficial effects of photobiomodulation (PBM) on testicular tissue and sperm parameters following Phe exposure in mice.

Methods

Twenty-four adult male mice, aged 8 weeks, were randomly divided into three groups: control, Phe, and Phe+PBM. In the Phe and Phe+PBM groups, mice received Phe (500 ng/kg) via gavage every 48 hours for 5 weeks. Following Phe exposure, the testes of the Phe+PBM mice were irradiated with laser photons every other day for 35 days. After euthanasia, epididymal tails and testes were collected for molecular and histological analyses.

Results

PBM significantly improved sperm count, motility, and viability (p<0.0001). Moreover, reactive oxygen species production, lipid peroxidation, and apoptosis were markedly reduced in the testicular tissue of the laser-treated mice (p<0.0001). Improvements were also observed in seminiferous epithelium thickness and cell distribution following PBM (p<0.0001).

Conclusion

Laser therapy significantly mitigates testicular damage from Phe exposure by reducing oxidative stress and apoptosis biomarkers, thereby improving testicular tissue and sperm parameters.

Introduction

Polycyclic aromatic hydrocarbons (PAHs) are a group of compounds formed by the fusion of two or more benzene rings. These organic substances primarily result from the incomplete combustion of organic materials and can enter the environment through events such as large forest fires or oil and gas leaks. PAHs pose significant health hazards, including to human health [1].
Phenanthrene (Phe) is a lightweight PAH composed of three benzene rings. Its stable structure makes it highly durable in the environment [2]. Phe is among the most abundant PAHs, exerting toxic effects on humans, animals, and plants. Research indicates that serum concentrations of Phe can be twice as high as those of other PAHs [3]. Phe is absorbed orally, dermally, and through inhalation, although ingestion via food intake constitutes the primary exposure route [4]. Varying amounts of this compound are found in drinking water and diverse food types, with concentrations dependent on factors such as the cooking method and raw materials used. Adverse impacts of Phe on the cardiovascular, gastrointestinal, and reproductive systems have been examined [5]. Research indicates that Phe can disrupt testicular tissue, impairing spermatogenesis and spermiogenesis [6]. Phe exposure has been linked to disturbances in the hypothalamic-pituitary-gonadal axis, potentially causing fertility issues or infertility [7]. Additionally, evidence suggests that exposure to Phe during pregnancy may harm male gonadal development in offspring [8]. Elevated oxidative stress and inflammation biomarkers have been implicated in the detrimental effects of Phe. Furthermore, this compound reduces the synthesis of proteins associated with cellular antioxidant functions by inducing DNA damage [9].
Photobiomodulation (PBM) involves the medical use of infrared or red light to enhance and repair tissue function [10]. In vivo studies have investigated the efficacy of PBM, demonstrating its capacity to promote wound healing, improve liver function, and stimulate neurogenesis without damaging cellular DNA [11]. Laser irradiation using near-infrared wavelengths effectively regulates mitochondrial function in target tissues, thereby preventing elevated free radical production [12]. Prior research indicates that laser irradiation notably reduces oxidative stress in testicular tissues induced by environmental factors such as heat shock [13]. Nevertheless, limited research has been conducted on the impact of PBM on PAH-induced tissue toxicity. Considering the prevalence of environmental pollution, this research was conducted to examine the effectiveness of laser therapy in mitigating oxidative stress, restoring seminiferous tubule tissue structure, and improving spermatogenesis following Phe exposure.

Methods

1. Animal model

Twenty-four adult male Naval Medical Research Institute (NMRI) mice, aged 8 weeks and weighing 25 to 30 g, were selected for this study. The mice were housed under standard laboratory conditions with a 12-hour light/dark cycle and unrestricted access to food and water. A 2-week acclimation period was provided for the mice to adjust to laboratory conditions. Animals were randomly allocated into three groups: control (Cont), Phe, and Phe+PBM. No intervention was given to the Cont group. In the Phe group, mice received a dose of Phe (500 ng/kg) via gavage every other day for 35 days. The Phe+PBM mice received Phe in the same manner as the Phe group, after which they were exposed to laser irradiation every other day for 5 weeks. Twenty-four hours following the final laser treatment, mice were euthanized under deep anesthesia induced by ketamine (100 mg/kg) and xylazine (10 mg/kg).

2. Chemical

Phe (CAS Number 85-01-8; purity 98%; Sigma-Aldrich) was dissolved in corn oil to achieve a concentration of 12 μg/mL [8,14].

3. Laser therapy

This study employed a pulsed infrared diode laser device operating at an 810-nm wavelength (Mustang 2000; LO7 Pen, Technica Co.). Laser energy was administered to the scrotal surface 1 day after the final Phe gavage. The radiation spot size was configured to 1 cm2, with each spot irradiated at a frequency of 80 Hz and an energy density of 0.03 J/cm2 for 180 µs per pulse. The duration of laser application at each point in a single session was 180 seconds. Laser sessions were conducted every other day over a period of 35 days [13].

4. Sperm analysis

Sperm motility, viability, and count were assessed. Mature sperm are crucial for these evaluations, as substantial motility development occurs after spermiation within the epididymis. Accordingly, mature sperm from the epididymal tail were used. Initially, the epididymal tail contents were extracted and placed in 1 mL of Ham’s F-10 solution, followed by 20 minutes of incubation at 37 °C. Subsequently, 10 µL of the sample was applied onto a slide to observe sperm motility. Five fields were randomly selected, with each observed for 30 seconds. Sperm were classified as motile or immotile. Motile sperm were further categorized into progressive (movement in a straight line or wide circle) or nonprogressive (rotation in a small circle).
Sperm viability was assessed using eosin-nigrosin dye. Under this protocol, 10 µL of the sample was combined with 10 µL of dye to prepare a smear, with sperm categorized as live (unstained) or dead (stained) based on the intensity of staining of the sperm heads. For sperm counting, 5 µL of the sample was analyzed using a Neubauer counting chamber, and the average count was reported.

5. Tissue preparation

After collection, samples were fixed in Bouin solution for 24 hours, followed by 10% formaldehyde fixative for 5 days. Following fixation, samples underwent dehydration to prevent putrefaction and were embedded in paraffin. Using a microtome (Leica RM2125 RTS; Leica Microsystems), samples were serially sectioned at a thickness of 7 µm for qualitative examination of testicular cells. Tissue samples were stained with hematoxylin and eosin, mounted, and examined under a light microscope. Ten sections per animal were randomly selected for analysis.

6. Histomorphometry

Data were extracted using ImageJ (National Institutes of Health). Images from slides were obtained using an optical microscope (Nikon) fitted with a Canon camera (Canon Inc.) at magnifications of ×4, ×10, and ×40.

7. Thickness of seminiferous tubule epithelium

Epithelial thickness was measured from the basement membrane to the sperm closest to the lumen at four different angles in 100 randomly selected tubules [15].

8. Germinal epithelium vacuolization assessment

Epithelial vacuolization was characterized by the presence of well-defined, spacious vacuoles lacking a membrane, observed at various epithelial depths. Images were analyzed using ImageJ to evaluate the degree of tissue vacuolization. Area fraction analysis was employed to determine the ratio of these vacuolated spaces in each group, and the results were compared [16].

9. Voronoi tessellation

The Voronoi tessellation method was used to investigate tissue cell distribution. Enlarged texture images and ImageJ plugins were used to generate polygons. Initially, cell nuclei were identified, and polygons were defined to represent the area occupied by a single cell. The software was then used to calculate the numbers and areas of the polygons. The coefficient of variation (CV), a comparative index of cell distribution, was computed using the following formula. The CV indicates regular (CV <33%), random (33%< CV <64%), or clustered distribution (CV >64%) [17].
CV=(standard deviation /mean)×100

10. Reactive oxygen species generation

To quantify reactive oxygen species (ROS) production in mouse testicular tissue, 50 mg of tissue was mixed with 100 μL of 20 µM dichlorofluorescin diacetate. After a 45-minute incubation at 37 °C, samples were fragmented using a sonicator and subsequently centrifuged at 1,500 rpm for 5 minutes following lysis. The supernatant was then removed, and absorbance was measured at a wavelength of 435 nm [18].

11. Lipid peroxidation

To assess lipid peroxidation, 10 mg of the left testis was homogenized with 300 μL of lysis buffer and 30 μL of butylated hydroxytoluene. The samples were centrifuged at 13,000 rpm for 3 minutes. Subsequently, 200 μL of the supernatant was collected and mixed with 800 μL of the working solution, then incubated in a water bath at 95 °C for 45 minutes. After cooling, the samples were centrifuged at 3,000 rpm for 15 minutes, and 250 μL of the supernatant was collected for analysis at a wavelength of 532 nm [19].

12. Real-time polymerase chain reaction

Following surgery and removal, the testes were stored at −80 °C along with RNAlater. After RNA extraction from the testicular tissue, samples were treated with DNase I to remove genomic DNA contamination. Complementary DNA was synthesized using a Fermentas kit at 42 °C for 60 minutes. Relative gene expression was quantified using real-time polymerase chain reaction (PCR) and the QuantiTect SYBR Green Real-Time PCR Kit. The data, including cycle threshold values, threshold cycles, and melting and proliferation curves for each gene, were analyzed. Relative gene expression changes were calculated using the 2−∆∆Ct method, with glyceraldehyde 3-phosphate dehydrogenase used as the internal control. Primer pairs for PCR were designed using Primer 3 Plus software, and their efficacy was verified using the Primer-BLAST tool before experimentation (Table 1).

13. Immunofluorescence

The expression of caspase-3 protein, a marker of apoptotic cell death, was evaluated in the testicular tissue. Slides were initially immersed in Tris buffer for 20 minutes. To increase membrane permeability, samples were subsequently washed three times with phosphate-buffered saline (PBS) and incubated with 0.3% Triton X-100 for 30 minutes. To minimize nonspecific secondary antibody binding, 10% goat serum was added to the samples. Next, samples were incubated with the primary antibody diluted in PBS at 4 °C for 24 hours. After washing with PBS, the secondary antibody was applied and incubated at 37 °C in darkness for 90 minutes. The slides were then washed and stained with 4′,6-diamidino-2-phenylindole (DAPI). For microscopy examination (Olympus), samples were mounted with glycerol mixed in PBS. ImageJ was used to quantify protein expression by analyzing fluorescence emission intensity.

14. Statistical analysis

Quantitative data were analyzed using SPSS version 21 (IBM Corp.). Initially, the Shapiro-Wilk test was applied to assess data normality. For data that were normally distributed, one-way analysis of variance and the Tukey post hoc test were employed for comparisons, with the results presented as mean±standard deviation. A p-value of less than 0.05 was considered to indicate statistical significance. GraphPad Prism version 9 (GraphPad Software Inc.) was also utilized for statistical analysis. Non-normally distributed data were analyzed using the Kruskal-Wallis test.

15. Ethical consideration

All procedures performed in this study were approved by the ethics committee of Shahid Beheshti University of Medical Sciences (IR.SBMU.LASER.REC.1402.021).

Results

1. Effect of PBM on sperm parameters in testes exposed to Phe

In mice exposed to Phe, sperm motility was significantly reduced relative to the Cont group (p<0.0001). Laser irradiation significantly mitigated this decrease (p<0.05). Furthermore, progressive sperm movement was significantly improved in the PBM-treated group (p<0.01) (Figure 1A, 1B). The sperm count in the epididymis of the Phe mice was significantly lower compared to the Cont group (p<0.0001). Similarly, laser therapy significantly increased this parameter (p<0.01) (Figure 1C). Finally, the percentage of viable sperm was significantly reduced in the Phe group compared to the Cont group (p<0.0001). Laser irradiation also improved sperm viability (p<0.001) (Figure 1D).

2. Effect of PBM on histomorphometric parameters in testes exposed to Phe

As shown in Figure 2A, 2B, following exposure to Phe, the thickness of the seminiferous tubule epithelium decreased relative to the Cont group (p<0.001). However, after PBM therapy, this parameter was significantly improved (p<0.05). As depicted in Figure 2C, 2D, the germinal epithelium vacuolization percentage was significantly higher in the Phe group compared to the Cont group (p<0.0001). In the Phe+PBM group, this parameter was significantly lower relative to the Phe group (p<0.001).

3. Effect of PBM on Voronoi tessellation parameters in testes exposed to Phe

Compared to the Cont group, the mean polygon size was significantly greater in the mice exposed to Phe (p<0.0001). However, this parameter was notably reduced in the PBM-treated group (p<0.0001). CV analysis revealed random cell arrangement in the Phe group (33%< CV <64%), whereas the Cont and Phe+PBM groups displayed regular arrangements (CV <33%). Additionally, data analysis showed that over 90% of the polygons in the Cont group were smaller than 80 μm2, whereas more than 60% of polygons in the Phe group exceeded 100 μm2 (Figures 3 and 4).

4. Effect of PBM on oxidative stress biomarkers in testes exposed to Phe

Following exposure to Phe, an increase in ROS production was noted in the testes of mice relative to the Cont group (p<0.0001). The Phe+PBM group exhibited a significant reduction in testicular ROS compared to the Phe group (p<0.0001) (Figure 5A). Malondialdehyde (MDA), a marker of lipid peroxidation, was significantly elevated in the testicular tissue of the Phe group compared to the Cont group (p<0.0001). In the PBM-treated mice, the MDA level was significantly lower than in the Phe group (p<0.01) (Figure 5B).

5. Effect of PBM on proliferative gene expression in testes exposed to Phe

Exposure to Phe markedly decreased the expressions of the proliferative genes C-kit and proliferating cell nuclear antigen (Pcna) in the testes of mice compared to the Cont group (p<0.0001 and p<0.0001, respectively). Following laser therapy, the expression levels of these genes were significantly increased relative to the Phe group (p<0.05 and p<0.05, respectively) (Figure 6).

6. Effect of PBM on caspase-3 expression in testes exposed to Phe

Figure 7 shows that caspase-3 protein expression in the testes of mice exposed to Phe was significantly higher compared to the Cont group (p<0.0001). Relative to the Phe group, the expression of this apoptotic marker was significantly decreased in the Phe+PBM group (p<0.01) (Figure 7).

Discussion

The study results indicate that PBM reduced the adverse effects of Phe, as evidenced by decreases in apoptosis and oxidative stress biomarkers in the testes. Furthermore, laser therapy improved the histomorphometric parameters of the testes and sperm in mice exposed to Phe.
Previous studies have indicated that Phe and its metabolites promote ROS generation and impair the antioxidant system in mammals [20]. Additionally, this substance elevates MDA concentrations through enhanced lipid peroxidation in earthworms [20]. In the current investigation, Phe elevated ROS production and lipid peroxidation in mice. These results align with the mouse study performed by Soltani et al. [21], in which laser irradiation decreased oxidative stress markers. In mammalian cells, mitochondria significantly contribute to ROS production and the initiation of oxidative stress [22]. Research indicates that wavelengths within the infrared range, like those used in the present study, primarily target mitochondria. A key component activated by laser radiation is cytochrome c oxidase, located at the terminal point of the mitochondrial respiratory chain, where it facilitates electron transfer from cytochrome c to oxygen molecules. By increasing the availability of cytochrome c oxidase for electron interactions, laser treatment promotes oxygen absorption, electron movement, and proton pumping, resulting in increased adenosine triphosphate production. Additionally, laser irradiation can boost mitochondrial function and cellular metabolism by influencing nitric oxide, another mitochondrial component [23]. Another notable effect of laser irradiation is the upregulation of cellular antioxidants such as superoxide dismutase and catalase [24]. Accordingly, laser radiation mitigates Phe-induced toxicity by enhancing mitochondrial membrane functionality and maintaining the balance between antioxidants and free radicals. It also regulates testicular tissue function, facilitating sperm production. These described mechanisms align with a study by Salman Yazdi et al. [25].
Another finding of the present study was the increased expression of the programmed cell death marker caspase-3 within the seminiferous tubules and interstitial testicular tissue following Phe exposure. Previous reports indicate that prolonged exposure to this substance is associated with the increased death of Sertoli and spermatogonial stem cells [8]. In vitro and in vivo research has identified mitochondrial dysfunction as a potential mechanism for the induction of apoptosis in tissues affected by high- and low-molecular-weight PAHs [26]. Additionally, the loss of Sertoli cells due to exposure to Phe during pregnancy and adulthood represents a potential mechanism for increased testicular apoptosis. Sertoli cells exhibit elevated metabolic activity to facilitate the secretion of growth factors essential for neighboring germ cell differentiation [27]. The abundance of mitochondria in Sertoli cell cytoplasm suggests they receive the highest number of laser photons among testicular cells. Thus, it is expected that regulating the metabolism of these cells would enhance spermatogenic epithelial function [28].
This study demonstrated a reduction in caspase-3 expression in mice subjected to laser therapy. Elevated ROS levels in testicular tissue after mitochondrial damage contribute to the activation of both intrinsic and extrinsic apoptosis pathways [29]. Consistent with the findings of Dreyer et al. [30], laser irradiation indirectly decreased caspase-3 expression by inhibiting free radicals and oxidative stress. The observations from the present study suggest that a reduction in effector caspase led to decreased vacuolization in the seminiferous epithelium and increased tubule diameter [30]. Therefore, it can be inferred that laser therapy reduces Phe cytotoxicity, decreasing apoptosis in the testes and restoring spermatogenic tubule structure.
Based on our observations in this study, the expression of the Pcna and C-kit genes, which are associated with the proliferation and self-renewal of spermatogonial cells, was reduced in mice exposed to Phe. After entering the body through the digestive system, this substance undergoes metabolism via the cytochrome P450 enzyme system. The active metabolites derived from this organic compound interact with nuclear DNA, leading to mutations, aberrant transcription, alterations in gene expression, and the initiation of apoptosis [31,32]. Furthermore, the overproduction of ROS and lipid peroxidation constitutes another mechanism implicated in cellular DNA damage resulting from Phe toxicity [9],14. Our observations indicated that gene expression in the testes increased following laser irradiation. The two aforementioned genes are expressed in testicular stem cells, which reside in a specialized microenvironment conducive to their proliferation and differentiation, both functionally and anatomically [33]. Any form of stress results in cytotoxicity and disrupts gene expression. In this context, PBM preserves the spermatogonial cell niche by mitigating elevated levels of oxidative stress. Additionally, laser photons have the capacity to mitigate harm to DNA by reducing damage and safeguarding DNA integrity. The findings of this research indicate that PBM decreases the generation of ROS and the expression of caspase-3, while enhancing the expression of genes critical for germ cell survival by regulating mitochondrial function in testicular cells. This enhancement ultimately results in improvements in testicular tissue and sperm parameters.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: AA, HAA, MN. Methodology: AA, FA, HN, RS. Formal analysis: FF, HN, RS. Data curation: FF, HAA, RS. Funding acquisition: MN. Project administration: MN. Visualization: FA, FF, HAA. Writing-original draft: AA, FA, RS. Writing-review & editing: AA, FA, HN, MN. Approval of final manuscript: HAA, HN, MN.

Figure 1.
Sperm count, motility, and viability improved following laser treatment in mice exposed to phenanthrene (Phe). (A) Total motility, (B) progressive motility, (C) sperm count, (D) viability, and (E) sperm stained with eosin-nigrosin at ×100 magnification. White arrowhead indicates viable sperm, while black arrows indicate non-viable sperm. All data are reported as mean±standard deviation. PBM, photobiomodulation. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=5).
cerm-2025-07983f1.jpg
Figure 2.
Testicular histomorphometric parameters improved following laser photon irradiation in mice exposed to phenanthrene (Phe). (A) Epithelial thickness. (B) Photomicrograph of testicular tissue at ×10 magnification showing the measurement method for epithelial thickness (blue lines). (C) Epithelial vacuolization. (D) Epithelial vacuolization indicated by white arrowheads in hematoxylin-eosin-stained testicular tissue at ×40 magnification. All data are reported as mean±standard deviation. PBM, photobiomodulation. a)p<0.05; b)p<0.001; c)p<0.0001 (n=5).
cerm-2025-07983f2.jpg
Figure 3.
Micrograph of seminiferous tubules and schematic representation using a Voronoi diagram of the seminiferous tubule epithelium. (A, D) Control group. (B, E) Phenanthrene (Phe) group. (C, F) Phe+photobiomodulation group.
cerm-2025-07983f3.jpg
Figure 4.
Analysis of the spatial pattern of testicular cells using Voronoi tessellation. (A) Following photobiomodulation (PBM), the mean size of Voronoi polygons significantly decreased. (B) The coefficient of variation (CV) in the laser-treated testes indicated a regular arrangement of cells. (C) The distribution of Voronoi polygon areas exhibits differences among the groups. Phe, phenanthrene. a)p<0.001; b)p<0.0001 (n=5).
cerm-2025-07983f4.jpg
Figure 5.
Reactive oxygen species (ROS) formation and malondialdehyde (MDA) content declined following laser irradiation in mice exposed to phenanthrene (Phe). (A) ROS levels. (B) MDA levels. All data are reported as mean±standard deviation. PBM, photobiomodulation. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=3).
cerm-2025-07983f5.jpg
Figure 6.
Photobiomodulation (PBM) increased the expression of proliferative genes in the testicular tissue of mice exposed to phenanthrene (Phe). (A) C-kit expression. (B) Proliferating cell nuclear antigen (Pcna) expression. All data are reported as mean±standard deviation. a)p<0.05; b)p<0.001; c)p<0.0001 (n=3).
cerm-2025-07983f6.jpg
Figure 7.
(A) Laser therapy reduced the expression of the apoptotic marker caspase-3 at the protein level in the testes of mice exposed to phenanthrene (Phe). Immunofluorescent staining of testicular tissue: control (Cont) group (B, C, D), Phe group (E, F, G), and Phe+photobiomodulation (PBM) group (H, I, J). All data are reported as mean±standard deviation. DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.01; b)p<0.0001 (n=4).
cerm-2025-07983f7.jpg
Table 1.
Design of forward and reverse primers
Genes Primer sequences Product size
Pcna F: GATGTGGAGCAACTTGGAAT 160 bp
R: AGCTCTCCACTTGCAGAAA
Stra8 F: TGTAGAGAGAGAGGTAGAGGAGT 151 bp
R: ATGTGGAGAGATGATGCTGTT
GAPDH F: CAGAACATCATCCCAGCCTCC 293 bp
R: TTGGCAGGTTTCTCAAGACGG

Pcna, proliferating cell nuclear antigen; Stra8, stimulated by retinoic acid 8; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

References

1. Sun K, Song Y, He F, Jing M, Tang J, Liu R. A review of human and animals exposure to polycyclic aromatic hydrocarbons: health risk and adverse effects, photo-induced toxicity and regulating effect of microplastics. Sci Total Environ 2021;773:145403.
crossref pmid
2. Sampaio GR, Guizellini GM, da Silva SA, de Almeida AP, Pinaffi-Langley AC, Rogero MM, et al. Polycyclic aromatic hydrocarbons in foods: biological effects, legislation, occurrence, analytical methods, and strategies to reduce their formation. Int J Mol Sci 2021;22:6010.
crossref pmid pmc
3. Chrysochou E, Kanellopoulos PG, Koukoulakis KG, Sakellari A, Karavoltsos S, Minaidis M, et al. Heart failure and PAHs, OHPAHs, and trace elements levels in human serum: results from a preliminary pilot study in greek population and the possible impact of air pollution. Molecules 2021;26:3207.
crossref pmid pmc
4. Zelinkova Z, Wenzl T. The occurrence of 16 EPA PAHs in food: a review. Polycycl Aromat Compd 2015;35:248-84.
crossref pmid pmc
5. He F, Hu S, Liu R, Li X, Guo S, Wang H, et al. Decoding the biological toxicity of phenanthrene on intestinal cells of Eisenia fetida: effects, toxicity pathways and corresponding mechanisms. Sci Total Environ 2023;904:166903.
crossref pmid
6. Huang J, Fang L, Zhang S, Zhang Y, Ou K, Wang C. Long-term exposure to environmental levels of phenanthrene disrupts spermatogenesis in male mice. Environ Pollut 2021;285:117488.
crossref pmid
7. Chen Y, Zhang Y, Yu Z, Guan Y, Chen R, Wang C. Early-life phenanthrene exposure inhibits reproductive ability in adult zebrafish and the mechanism of action. Chemosphere 2021;272:129635.
crossref pmid
8. Afshar A, Nazarian H, Fadaefathabadi F, Aghajanpour F, Soltani R, Abdollahifar MA, et al. Maternal exposure to phenanthrene induces testicular apoptosis and Sertoli cell dysfunction in F1 adult male mice: a histological and molecular study. Clin Exp Reprod Med 2025;52:87-97.
crossref pmid pmc pdf
9. Ma H, Wang H, Zhang H, Guo H, Zhang W, Hu F, et al. Effects of phenanthrene on oxidative stress and inflammation in lung and liver of female rats. Environ Toxicol 2020;35:37-46.
crossref pmid pdf
10. Dompe C, Moncrieff L, Matys J, Grzech-Lesniak K, Kocherova I, Bryja A, et al. Photobiomodulation-underlying mechanism and clinical applications. J Clin Med 2020;9:1724.
crossref pmid pmc
11. Hashmi JT, Huang YY, Sharma SK, Kurup DB, De Taboada L, Carroll JD, et al. Effect of pulsing in low-level light therapy. Lasers Surg Med 2010;42:450-66.
crossref pmid pmc pdf
12. Amaroli A, Pasquale C, Zekiy A, Utyuzh A, Benedicenti S, Signore A, et al. Photobiomodulation and oxidative stress: 980 nm diode laser light regulates mitochondrial activity and reactive oxygen species production. Oxid Med Cell Longev 2021;2021:6626286.
crossref pmid pmc pdf
13. Aghajanpour F, Abbaszadeh HA, Nazarian H, Afshar A, Soltani R, Bana Derakhshan H, et al. Photobiomodulation improves histological parameters of testis and spermatogenesis in adult mice exposed to scrotal hyperthermia in the prepubertal phase. J Lasers Med Sci 2024;15:e49.
crossref pmid pmc pdf
14. Afshar A, Nazarian H, Fadaefathabadi F, Mastery-Farahani R, Aghajanpour F, Soltani R, et al. Prenatal exposure to phenanthrene impairs spermatogenesis and fertility by elevating apoptosis, altering gene expression, and disrupting steroidogenesis in adult male mice across two generations. Reprod Toxicol 2025;134:108897.
crossref pmid
15. Yalcin T, Kaya S, Tektemur NK, Ozan IE. The methods used in histopathological evaluation of testis tissues. Batman Univ J Life Sci 2020;10:148-57.

16. Mahmoudi A, Hadrich F, Bouallagui Z, Feki I, Ghorbel H, Ayadi L, et al. Comparative study of the effect of oleuropein and hydroxytyrosol rich extracts on the reproductive toxicity induced by bisphenol A in male rats: biochemical, histopathological, and molecular analyses. Environ Sci Pollut Res Int 2023;30:78735-49.
crossref pmid pdf
17. Aryan A, Aghajanpour F, Dashtdar M, Hejazi F, Salimi M, Afshar A, et al. Exploring intercellular dynamics: ultra-weak biophoton emission as a novel indicator of altered cell functions and disease in oligospermia mice. J Lasers Med Sci 2023;14:e65.
crossref pmid pmc pdf
18. Aghajanpour F, Soltani R, Afshar A, Abbaszadeh HA, Fadaei Fathabadi F, Moeinian N, et al. Sertoli cell-conditioned medium can improve blood-testis-barrier function and spermatogenesis in azoospermia mice induced by scrotal hyperthermia: an experimental study. Int J Reprod Biomed 2024;22:17-30.
crossref pmid pmc pdf
19. Tsikas D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: analytical and biological challenges. Anal Biochem 2017;524:13-30.
crossref pmid
20. Wu S, Wu E, Qiu L, Zhong W, Chen J. Effects of phenanthrene on the mortality, growth, and anti-oxidant system of earthworms (Eisenia fetida) under laboratory conditions. Chemosphere 2011;83:429-34.
crossref pmid
21. Soltani R, Abbaszadeh HA, Nazarian H, Tabeie F, Akbari H, Mohammadzadeh I, et al. The impact of photobiomodulation therapy on enhancing spermatogenesis and blood-testis barrier integrity in adult male mice subjected to scrotal hyperthermia. J Lasers Med Sci 2024;15:e43.
crossref pmid pmc pdf
22. Hamblin MR. Mechanisms and mitochondrial redox signaling in photobiomodulation. Photochem Photobiol 2018;94:199-212.
crossref pmid pmc pdf
23. Suski JM, Lebiedzinska M, Bonora M, Pinton P, Duszynski J, Wieckowski MR. Relation between mitochondrial membrane potential and ROS formation. Methods Mol Biol 2012;810:183-205.
crossref pmid
24. Wong-Riley MT, Liang HL, Eells JT, Chance B, Henry MM, Buchmann E, et al. Photobiomodulation directly benefits primary neurons functionally inactivated by toxins: role of cytochrome c oxidase. J Biol Chem 2005;280:4761-71.
crossref pmid
25. Salman Yazdi R, Bakhshi S, Jannat Alipoor F, Akhoond MR, Borhani S, Farrahi F, et al. Effect of 830-nm diode laser irradiation on human sperm motility. Lasers Med Sci 2014;29:97-104.
crossref pmid pdf
26. Das DN, Naik PP, Mukhopadhyay S, Panda PK, Sinha N, Meher BR, et al. Elimination of dysfunctional mitochondria through mitophagy suppresses benzo[a]pyrene-induced apoptosis. Free Radic Biol Med 2017;112:452-63.
crossref pmid
27. Ruthig VA, Lamb DJ. Updates in Sertoli cell-mediated signaling during spermatogenesis and advances in restoring Sertoli cell function. Front Endocrinol (Lausanne) 2022;13:897196.
crossref pmid pmc
28. Tabatabaee F, Darabi S, Soltani R, Aghajanpour F, Afshar A, Abbaszadeh HA, et al. Therapeutic effects of exosome therapy and photobiomodulation therapy on the spermatogenesis arrest in male mice after scrotum hyperthermia. J Lasers Med Sci 2024;15:e3.
crossref pmid pmc pdf
29. Wang C, Youle RJ. The role of mitochondria in apoptosis. Annu Rev Genet 2009;43:95-118.
crossref pmid pmc
30. Dreyer T, Siqueira AFP, Magrini TD, Fiorito PA, Assumpcao MEOA, Nichi M, et al. Biochemical and topological analysis of bovine sperm cells induced by low power laser irradiation. In: Sroka R, Lilge LD, editors. Medical laser applications and laser-tissue interactions V. European Conference on Biomedical Optics 2011; 2011 May 22-26; Munich, Germany: 2011.

31. Bhagat J, Sarkar A, Ingole BS. DNA damage and oxidative stress in marine gastropod Morula granulata exposed to phenanthrene. Water Air Soil Pollut 2016;227:114.
crossref pdf
32. Shi Z, Wen M, Zhang J, Tang Z, Wang C. Effect of phenanthrene on the biological characteristics of earthworm casts and their relationships with digestive and anti-oxidative systems. Ecotoxicol Environ Saf 2020;193:110359.
crossref pmid
33. Scadden DT. Nice neighborhood: emerging concepts of the stem cell niche. Cell 2014;157:41-50.
crossref pmid pmc
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  •   Scopus
  • 1,802 View
  • 42 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next