Clin Exp Reprod Med Search

CLOSE


Clin Exp Reprod Med > Volume 53(1); 2026 > Article
Azimi, Abdollahifar, Zarrinpour, and Aliaghaei: Tramadol induces hormonal imbalance, histopathology, and altered ovarian gene expression in mice

Abstract

Objective

Tramadol is a centrally acting analgesic with a modest opioid effect similar to morphine and codeine, but less potent; it is mainly prescribed for the treatment of mild to moderate pain. Tramadol exhibits both opioid and non-opioid properties, primarily affecting the central nervous system. Accordingly, the present study was designed to investigate the effects of tramadol on female reproductive function and ovarian toxicity, as well as to examine oocyte survival and follicular development in mice exposed to tramadol.

Methods

Mice were treated with tramadol at 50 mg/kg daily for 3 weeks. Blood levels of the hormones estrogen and progesterone were measured. The ovaries of the mice were subjected to histological, immunohistochemical, and molecular studies.

Results

Our results revealed that tramadol provoked ovarian atrophy by inducing oxidative stress, while also decreasing oocyte survival and impairing follicular development.

Conclusion

Although further research is necessary, the findings indicate that tramadol could reduce fertility in female mice.

Introduction

Chronic pain is one of the most frequent concerns reported by patients [1]. Despite the recent advent of novel medications, opioid analgesic agents remain the most effective treatment for moderate to severe pain [2]. Opiates are natural compounds derived from opium, which is obtained from the fruit of Papaver somniferum [3]. The term ‘opioid’ refers to any chemical, biological, or synthetic agent that acts on opioid receptors to produce morphine-like analgesic effects [4]. Tramadol is a centrally acting analgesic with a modest opioid effect similar to morphine and codeine, but less potent [1,5,6]. Due to its distinct pharmacological properties, tramadol has fewer side effects and lower abuse potential than other opioid medicines, and thus may be preferred [7]. The oral absorption of tramadol is 100%, with a mean bioavailability of 70%. This includes a 20% to 30% first-pass hepatic metabolism after a single oral dose. However, after multiple oral doses, the bioavailability of tramadol can increase to 100% due to saturated first-pass hepatic metabolism [8]. As with any other opiate, long-term use of tramadol may lead to addiction as well as physical and psychological dependence [9].
Drugs may interfere with fertility by causing hormonal imbalance and thus influencing the production and secretion of essential pituitary hormones. These include luteinizing hormone (LH), which induces ovulation, as well as follicle-stimulating hormone (FSH) [10]. Studies have repeatedly demonstrated the effect of chronic tramadol abuse on the male reproductive system, indicating that it can impact libido, affect ejaculation, and trigger hypogonadism, also known as opioid-induced androgen deficiency [11]. However, limited data are available regarding opioid endocrinopathy in women.
Opioids have been shown to impair female endocrine function and lead to an imbalance of sex steroids [1]. For instance, reports indicate that women addicted to heroin are more likely to experience hypomenorrhea, amenorrhea, and sexual dysfunction than those who are not addicted [12-14]. Nonsurgical amenorrhea was also reported in 52% of opioid-using women aged 30 to 50 years compared to 20% in the control group, indicating opioid-induced endocrinopathy [15]. Prior research has also demonstrated significant deterioration of ovarian follicles and increases in the numbers of atretic and cystic follicles following tramadol exposure. This depletion was accompanied by impaired ovarian function, as evidenced by a decrease in ovulated oocytes and a prolonged estrous cycle duration [16].
Tramadol abuse may also lead to the accumulation of toxic metabolites, causing oxidative stress and subsequent toxicity and infertility [17]. It can decrease LH, FSH, and antioxidant enzyme activity, while increasing lipid peroxidation, nitric oxide, estrogen, and prolactin levels [10,18]. Considering its easy accessibility and widespread use, any adverse effects should be thoroughly investigated. Therefore, in the present study, we compared the hormonal and histopathological properties of female mice exposed to tramadol with those of healthy controls to assess any potential tramadol-induced damage to the female reproductive system.

Methods

Antibodies against Ki67 (1:300) and growth differentiation factor 9 (GDF9; 1:300), as well as secondary antibodies, were obtained from Abcam. RNAXplus was purchased from Qiagen Ltd. Tramadol hydrochloride tablets were acquired from Pharma Chemie Pharmaceutical Co.

1. Animals and treatment

In this study, 24 adult female Naval Medical Research Institute (NMRI) mice (30 to 25 g and 8 weeks old) were obtained from the Laboratory Animal Center of our university. The university’s ethics committee approved this animal experiment (IR.SBMU.MSP.REC.1400.733). The mice were housed at 22 °C under a 12-hour light/12-hour dark cycle, with ad libitum access to water and food. They were randomly assigned to a control group and an experimental group (n=12 in each). As previously reported, the control group was treated daily with normal saline (0.9% NaCl, oral gavage) for 3 weeks [19]. In the tramadol group, the mice received daily tramadol hydrochloride tablets (dissolved in physiological saline) via oral gavage for 3 weeks at 50 mg/kg [20]. To synchronize the estrous cycles of the mice, 0.5 μg of cloprostenol acetate was injected intraperitoneally on the first day, and 3 μg of progesterone was injected subcutaneously after 3 days.

2. Serum progesterone and estradiol measurement

Blood samples were obtained from the heart during deep anesthesia. The samples were centrifuged at 6,000 ×g for 5 minutes at 4 °C before being stored at −80 °C until use. A mouse-specific enzyme-linked immunosorbent assay kit was used to measure serum levels of progesterone (ab28521; Abcam) and estradiol (ab285237; Abcam).

3. Histopathology

At the end of the experiment, the mice were anesthetized, and their ovaries were removed and fixed in 4% neutral buffered formalin. After tissue processing, the samples were embedded in paraffin blocks. Complete serial sections (10 μm thick) were prepared using a microtome. For each animal, approximately 10 sections were selected using systematic random sampling. The sections were stained with hematoxylin and eosin. The numbers of primordial, primary, secondary, and antral follicles, as well as corpora lutea, were estimated using a Nikon E200 microscope (Nikon) connected to a camera. Microscopic fields were selected via systematic uniform random sampling by moving the microscope stage at equal intervals to estimate the numbers of follicles and corpora lutea [21,22]. An optical dissector design was employed to ensure unbiased tissue sampling. Numerical density (Nv) was calculated as follows:
Nv=ΣQΣP×h×af×tBA
where ‘ΣQ’ denotes the number of nuclei, ‘ΣP’ represents the total number of unbiased counting frames in all fields, ‘h’ refers to the height of the dissector, ‘a/f’ indicates the frame area, ‘t’ denotes the actual section thickness measured in each field using the microcator, and ‘BA’ represents the block advance of the microtome.

4. Immunohistochemistry

For the immunohistochemistry analysis, the animals were deeply anesthetized using 100 mg/kg ketamine and 10 mg/kg xylazine. Transcardial perfusion was performed with 0.1 M phosphate-buffered saline (PBS) (pH=7.4) followed by 4% paraformaldehyde in 0.1 M PBS (pH=7.4). The ovary was removed and post-fixed in the same fixative for 24 hours. In accordance with protocols, the tissues were then dehydrated through a series of graded ethanol baths and subsequently infiltrated with paraffin using a tissue-embedding machine. Using a microtome, sections (5 μm thick) were cut from the formalin-fixed paraffin-embedded tissue samples, deparaffinized, and rehydrated. The tissues were then incubated with a protein block for 5 minutes at room temperature and washed with buffer to reduce nonspecific background staining. Next, the sections were incubated with primary antibodies against GDF9 and Ki67 overnight at 4 °C. The following morning, the tissues were washed four times with buffer. Secondary antibodies (conjugated with tetramethylrhodamine [TRITC] or fluorescein isothiocyanate [FITC]) were used for immunofluorescence detection. Finally, the tissues were incubated for 10 minutes and washed with buffer. After the immunohistochemical reaction, the tissues were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) and examined under a fluorescence microscope.

5. Gene expression

Following the manufacturers’ instructions for TRIzol and the RNeasy Lipid Tissue Mini Kit (Qiagen), ovary lysates from three mice per group were pooled for total RNA isolation. Control and tramadol samples were prepared from the RNA extracted from the pooled ovary lysates. The samples were washed in 25 μL of RNase-free H2O and quantified with a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific). RNA quality was assessed using agarose gel electrophoresis and the Bioanalyzer 2100 system (Agilent Technologies Inc.). All samples displayed a concentration of >100 ng/µL and an RNA integrity number of ≥8.
Quantitative real-time polymerase chain reaction was performed using specific primers for nuclear factor erythroid 2-related factor 2 (NRF2), γ-glutamylcysteine synthetase (γ-GCS), GDF9, Ki67, FSH receptor (FSHR), caspase-3, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene (Table 1). Relative mRNA expression levels for FSHR, GDF9, NRF2, and γ-GCS were normalized between the groups and quantified relative to the control.

6. Data analyses

All statistical analyses were performed using SPSS ver. 23 (IBM Corp.). The graphs were created using GraphPad Prism 7 (GraphPad Software Inc.). Data are presented as mean±standard deviation. Differences between experimental groups were evaluated using an independent samples t-test. p-values less than 0.05 were considered to indicate statistical significance.

Results

1. Hormonal assay

Progesterone levels did not differ significantly between the tramadol and control groups (Figure 1A). In contrast, the estradiol level was considerably lower in the tramadol group compared with the control animals (p<0.05) (Figure 1B).

2. Histopathological and stereological observations

The stereological analysis revealed that the numbers of primordial, primary, and secondary follicles were significantly lower in the tramadol group compared with the control group (p<0.001, p<0.01, and p<0.001, respectively) (Figures 2 and 3). The numbers of corpora lutea and antral follicles were also significantly lower in the tramadol group (p<0.05, p<0.01, and p<0.01, respectively) (Figure 4).

3. Immunofluorescence patterns of GDF9 and Ki67

The expression of GDF9 in oocytes was significantly lower in the tramadol group compared with the control animals (p<0.001) (Figure 5). Immunofluorescence staining also demonstrated that tramadol decreased oocyte growth and granulosa cell proliferation, as indicated by reduced protein Ki67 expression (p<0.001) (Figure 6).

4. mRNA expression levels of FSHR, GDF9, NRF2, and γ-GCS

The mRNA expression levels of FSHR, GDF9, NRF2, and γ-GCS in the mouse ovarian tissue were significantly reduced in the tramadol group compared with the control animals (p<0.05 for all) (Figure 7).

Discussion

In this study, we evaluated adult female rats treated with tramadol by assessing their hormone levels, follicular counts, and expression of oocyte proliferation markers. The results were compared with those of an age- and sex-matched control group.
The choice of effective analgesic treatment for a target species remains a subject of debate among animal welfare bodies, researchers, and veterinarians. This uncertainty stems from the complexities of the underlying biological processes, available data on the efficacy and pharmacokinetics of appropriate analgesics in the target strain or species, and potential interactions with experimental tests [23,24].
Both in vitro and in vivo investigations have demonstrated that tramadol effectively inhibits the reuptake of monoamines, including serotonin in the raphe nucleus. Since antidepressant drugs primarily function by blocking norepinephrine/serotonin reuptake, tramadol’s inhibition of monoaminergic reuptake may also confer antidepressant effects [25].
Following the administration of tramadol at 50 mg/kg for 21 days, blood samples were collected, and hormone tests were performed to assess progesterone and estradiol levels. The results indicated that the levels of both hormones were reduced; however, the reduction was statistically significant only for estradiol. According to Ballantyne et al. [26], long-term opiate use has deleterious consequences on sex hormone levels. Tramadol exposure was shown to significantly reduce both male (testosterone) and female (progesterone and estrogen) hormone levels, as well as cortisol, in rabbits. These findings imply that long-term opioid therapy could suppress the adrenal and hypothalamic-pituitary-gonadal (HPG) axes [27,28]. Studies have also reported decreased FSH levels, suggesting that tramadol disrupts normal hypothalamic-pituitary function. In other words, tramadol may interfere directly with the pituitary release of LH and FSH, potentially disrupting the menstrual cycle in women by blunting the regular pulsatile release of LH [27,29].
Furthermore, opioids have been shown to affect the release of gonadotropin-releasing hormone (GnRH) in the hypothalamus [30]. Bliesener et al. [31] explained that the impact of tramadol on GnRH is mediated by elevated prolactin levels, which contribute to the decrease in GnRH. Thus, the HPG axis may be affected by tramadol at multiple points [32]. Our gene expression analysis also demonstrated that the expression of the FSH receptor was significantly decreased following tramadol administration, suggesting that reduced sensitivity to pituitary hormones may exacerbate the hormonal imbalance induced by tramadol.
Histological analysis of ovarian tissue in our study revealed that primary, primordial, secondary, and antral follicles decreased significantly after tramadol exposure; in contrast, the number of corpora lutea increased, findings consistent with those of Mohamed and Mohamed [33].
The poor survival of oocytes may explain the disruption in follicular development. In this regard, our immunohistochemical studies demonstrated significant reductions in the expression levels of the proliferation markers GDF9 and Ki67 in the oocytes of tramadol-exposed mice compared with controls. Moreover, gene expression analysis confirmed a lower GDF9 level in the tramadol-exposed group. Mohamed and Mohamed [33] also reported a significant decrease in Bcl2 immunostaining in tramadol-exposed animals. Additionally, cell death has been reported following tramadol administration in other cell types, such as neurons and hepatocytes, suggesting that the toxic effects of tramadol may contribute to the impaired follicular development observed [34,35]. Similar findings were reported by Mao et al. [36], who found that tramadol downregulates the anti-apoptotic protein Bcl-2 while increasing the proapoptotic Bax protein. In another study, Khodeary et al. [37] revealed that an imbalance between Bcl-2 and Bax led to apoptosis and caspase-3 activation. These findings indicate that tramadol treatment impairs cell survival, primarily by reducing proliferation and increasing apoptotic activity.
Our gene analysis revealed decreased expression of genes associated with the antioxidant system, including Nrf2 and γ-GCS. The capacity of tramadol to generate reactive oxygen species (ROS) and free radicals, which can damage cell membranes, may explain the degenerative alterations and cell death induced by its long-term use. This tramadol-induced oxidative stress typically results in cell membrane instability and disintegration due to lipid peroxidation [10]. Mohamed et al. [38] further explained the mechanism underlying the increased ROS generation in response to tramadol exposure by demonstrating decreases in the activities of mitochondrial electron transport chain complexes I, III, and IV, but not complex II, in rats exposed to tramadol.
Mohamed and Mahmoud [39] also found that tramadol can reduce the activity and expression of antioxidant defense enzymes while promoting lipid peroxidation. From an immunologic perspective, Hussein et al. [40] demonstrated that tramadol treatment increased interleukin 1B (IL-1B) and tumor necrosis factor alpha levels. These findings were consistent with those of Elwy and Tabl [41], who observed elevated IL-1B serum levels following tramadol administration.
Based on other research, tramadol is associated with improved immunological function both in vivo and in vitro, along with degradation of the endogenous antioxidant defense system. For instance, Sacerdote et al. [42] revealed that tramadol treatment increased natural killer activity and splenocyte proliferation in mice. Chronic tramadol treatment results in increased activity and expression of inflammatory and apoptotic markers and a reduction in anti-apoptotic proteins.
In summary, tramadol-induced oxidative stress impairs the natural survival mechanisms of the oocyte, which may hinder follicular development. In addition to these cellular effects, tramadol causes hormonal imbalance, disrupting the menstrual cycle and affecting oocyte survival and follicular development.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: VZ, AA. Methodology: HA. Formal analysis: MAA. Data curation: MAA. Funding acquisition: VZ, AA. Project administration: VZ, AA. Visualization: AA. Software: MAA. Validation: MAA, AA. Investigation: HA. Writing-original draft: HA. Writing-review & editing: VZ, AA. Approval of final manuscript: VZ, AA.

Figure 1.
Effects of tramadol on serum (A) progesterone and (B) estradiol levels in the ovaries of female rats. Results are presented as mean±standard deviation. a)p<0.05.
cerm-2024-07773f1.jpg
Figure 2.
Hematoxylin and eosin staining of ovaries in the study: (A) control and (B) tramadol groups (×10 magnification). P.F, primordial follicle; CL, corpus luteum; Gr, Graafian follicle; Pr.F, primary follicle; An, antral follicle.
cerm-2024-07773f2.jpg
Figure 3.
Comparisons of the total numbers of (A) primordial follicles, (B) primary follicles, and (C) secondary follicles in the control and tramadol groups. Results are presented as mean±standard deviation. a)p<0.01; b)p<0.001.
cerm-2024-07773f3.jpg
Figure 4.
Comparisons of the total numbers of (A) corpora lutea, (B) antral follicles, and (C) Graafian follicles in the control and tramadol groups. Results are presented as mean±standard deviation. a)p<0.05; b)p<0.01.
cerm-2024-07773f4.jpg
Figure 5.
immunohistochemistry analysis. (A) Immunofluorescence pattern of growth differentiation factor 9 (GDF9) in the ovaries of the control and tramadol groups. (B) Results are presented as mean±standard deviation. DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.001.
cerm-2024-07773f5.jpg
Figure 6.
Immunohistochemistry analysis. (A) Immunofluorescence pattern of Ki67 in the ovaries of the control and tramadol groups. (B) Results are presented as mean±standard deviation. DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.01.
cerm-2024-07773f6.jpg
Figure 7.
Real‐time polymerase chain reaction analyses of the ovary. Messenger RNA expression levels of follicle-stimulating hormone receptor (FSHR), growth differentiation factor 9 (GDF9), nuclear factor erythroid 2-related factor 2 (NRF2), and γ-glutamylcysteine synthetase (γ-GCS) in the control and tramadol groups. Results are presented as mean±standard deviation. a)p<0.05.
cerm-2024-07773f7.jpg
Table 1.
qPCR performed using specific primers for NRF2, γ-GCS, GDF9, Ki67, FSHR, caspase-3, and GAPDH
Primer name Sequence Annealing Accession number
GDF9 F: 5' AATGGGACAACTGGATCGTGG 3' 59 °C×25 sec NM_021672.1
R: 5' AATGGTCAACACGCTCAAGG 3'
FSHR F: 5' GACCACAAGCCAATACAAACTAAC 3' 59 °C×25 sec NM_199237.2
R: 5' AAAAGCCAGCAGCATCACAG 3'
Nrf2 F: 5' TTTCAGCAGCATCCTCTCCAC 3' 56 °C×25 sec AF304364
R: 5' TCACACCCTTCAATAGTCCC 3'
GAPDH F: 5' ATGGAGAAGGCTGGGGCTCACCT 3' 60 °C×25 sec NM_017008.4
R: 5' AGCCCTTCCACGATGCCAAAGTTGT 3'
γ-GCS F: 5' CTCTGCACCATCACTTCATTCC 3' 59 °C×25 sec J05181
R: 5' ATGACAACCTTTTCTCCTCTCC 3'

qPCR, quantitative real-time polymerase chain reaction; NRF2, nuclear factor erythroid 2-related factor 2; γ-GCS, γ-glutamylcysteine synthetase; GDF9, growth differentiation factor 9; FSHR, follicle-stimulating hormone receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse.

References

1. El-Mottaleb HAAA, Mahmoud SF, Hassan AI, Tealeb ASMI, Almorsy GZ. Effects of chronic use of tramadol on uterus and ovary of albino rats. Egypt J Hosp Med 2019;76:3184-90.
crossref
2. Vazzana M, Andreani T, Fangueiro J, Faggio C, Silva C, Santini A, et al. Tramadol hydrochloride: pharmacokinetics, pharmacodynamics, adverse side effects, co-administration of drugs and new drug delivery systems. Biomed Pharmacother 2015;70:234-8.
crossref pmid
3. Moussa M, Tolba N, Ashry S, Ali A. Impact of chronic tramadol intake on reproductive hormones and related histopathological changes in adult albino rats. Ain Shams J Forensic Med Clin Toxicol 2020;35:1-13.
crossref
4. Pasternak GW. Incomplete cross tolerance and multiple mu opioid peptide receptors. Trends Pharmacol Sci 2001;22:67-70.
crossref pmid
5. Lavasani H, Sheikholeslami B, Ardakani YH, Abdollahi M, Hakemi L, Rouini MR. Study of the pharmacokinetic changes of Tramadol in diabetic rats. Daru 2013;21:17.
crossref pmid pmc pdf
6. Elhomosany NM. Effect of tramadol on the ovaries of female mice. Egypt J Histol 2021;44:805-13.

7. Andurkar SV, Gendler L, Gulati A. Tramadol antinociception is potentiated by clonidine through α₂-adrenergic and I₂-imidazoline but not by endothelin ET(A) receptors in mice. Eur J Pharmacol 2012;683:109-15.
crossref pmid
8. Skinner DJ, Epstein J, Pappagallo M. Tramadol. In: Smith HS, editor. Current therapy in pain. Elsevier; 2009. p. 508-12.

9. Zhang H, Liu Z. The investigation of tramadol dependence with no history of substance abuse: a cross-sectional survey of spontaneously reported cases in Guangzhou City, China. Biomed Res Int 2013;2013:283425.
crossref pmid pmc pdf
10. Ahmed MA, Kurkar A. Effects of opioid (tramadol) treatment on testicular functions in adult male rats: the role of nitric oxide and oxidative stress. Clin Exp Pharmacol Physiol 2014;41:317-23.
crossref pmid
11. Attia AM, Yassin HA, Sarhan NI, Gamal NA, Bakry OA. Effect of tramadol on the male reproductive system and sexual health. Menoufia Med J 2021;34:1.
crossref
12. Schmittner J, Schroeder JR, Epstein DH, Preston KL. Menstrual cycle length during methadone maintenance. Addiction 2005;100:829-36.
crossref pmid
13. Afrasiabi MA, Flomm M, Friedlander H, Valenta LJ. Endocrine studies in heroin addicts. Psychoneuroendocrinology 1979;4:145-53.
crossref pmid
14. Facchinetti F, Comitini G, Petraglia F, Volpe A, Genazzani AR. Reduced estriol and dehydroepiandrosterone sulphate plasma levels in methadone-addicted pregnant women. Eur J Obstet Gynecol Reprod Biol 1986;23:67-73.
crossref pmid
15. Darnall BD, Stacey BR, Chou R. Medical and psychological risks and consequences of long-term opioid therapy in women. Pain Med 2012;13:1181-211.
crossref pmid pmc
16. El-Ghawet HA. Effects of tramadol on the reproductive function of wistar albino rats. Eur J Exp Biol 2015;5:56-64.

17. Shadnia S, Soltaninejad K, Heydari K, Sasanian G, Abdollahi M. Tramadol intoxication: a review of 114 cases. Hum Exp Toxicol 2008;27:201-5.
crossref pmid pdf
18. Amadi NM, Achukwu PU, Anoh NV, Obeagu EI, Achukwu NO, Odo OF. Reproductive organ activities of Morinda lucida ethanol root extract on male and female albino rats tramadol HCL induced infertility. J Pharm Res Int 2021;33(46B):287-95.
crossref pdf
19. Atcha Z, Rourke C, Neo AH, Goh CW, Lim JS, Aw CC, et al. Alternative method of oral dosing for rats. J Am Assoc Lab Anim Sci 2010;49:335-43.
pmid pmc
20. Aghajanpour F, Boroujeni ME, Jahanian A, Soltani R, Ezi S, Khatmi A, et al. Tramadol: a potential neurotoxic agent affecting prefrontal cortices in adult male rats and PC-12 cell line. Neurotox Res 2020;38:385-97.
crossref pmid pdf
21. Gundersen HJ, Bendtsen TF, Korbo L, Marcussen N, Moller A, Nielsen K, et al. Some new, simple and efficient stereological methods and their use in pathological research and diagnosis. APMIS 1988;96:379-94.
crossref pmid
22. Gundersen HJ, Bagger P, Bendtsen TF, Evans SM, Korbo L, Marcussen N, et al. The new stereological tools: disector, fractionator, nucleator and point sampled intercepts and their use in pathological research and diagnosis. APMIS 1988;96:857-81.
crossref pmid
23. Evangelista Vaz R, Draganov DI, Rapp C, Avenel F, Steiner G, Arras M, et al. Preliminary pharmacokinetics of tramadol hydrochloride after administration via different routes in male and female B6 mice. Vet Anaesth Analg 2018;45:111-22.
crossref pmid
24. Grond S, Sablotzki A. Clinical pharmacology of tramadol. Clin Pharmacokinet 2004;43:879-923.
crossref pmid
25. Kiayias JA, Vlachou ED, Lakka-Papadodima E. Venlafaxine HCl in the treatment of painful peripheral diabetic neuropathy. Diabetes Care 2000;23:699.
crossref pmid pdf
26. Ballantyne JC. Opioid analgesia: perspectives on right use and utility. Pain Physician 2007;10:479-91.
crossref pmid
27. Colameco S, Coren JS. Opioid-induced endocrinopathy. J Am Osteopath Assoc 2009;109:20-5.
pmid
28. Aloisi AM, Ceccarelli I, Fiorenzani P, Maddalena M, Rossi A, Tomei V, et al. Aromatase and 5-alpha reductase gene expression: modulation by pain and morphine treatment in male rats. Mol Pain 2010;6:69.
crossref pmid pmc pdf
29. Ghowsi M, Yousofvand N. Impact of morphine dependency and detoxification by methadone on male's rat reproductive system. Iran J Reprod Med 2015;13:275-82.
pmid pmc
30. Brennan MJ. The effect of opioid therapy on endocrine function. Am J Med 2013;126(3 Suppl 1):S12-8.
crossref pmid
31. Bliesener N, Albrecht S, Schwager A, Weckbecker K, Lichtermann D, Klingmuller D. Plasma testosterone and sexual function in men receiving buprenorphine maintenance for opioid dependence. J Clin Endocrinol Metab 2005;90:203-6.
crossref pmid
32. Katz N, Mazer NA. The impact of opioids on the endocrine system. Clin J Pain 2009;25:170-5.
crossref pmid
33. Mohamed HZE, Mohamed HS. Histological and immunohistochemical study of the effects of tramadol administration on the ovaries of adult albino rats and the possible recovery after its withdrawal. Egypt J Histol 2021;44:256-70.
crossref
34. Helmy MA, Abdalla HA, Abd El Rahman HA, Ahmed DA. Hepatotoxic effect of tramadol and O-desmethyltramadol in HepG2 cells and potential role of PI3K/AKT/mTOR. Xenobiotica 2021;51:1029-37.
crossref pmid
35. Sarhan NR, Taalab YM. Oxidative stress/PERK/apoptotic pathways interaction contribute to tramadol neurotoxicity in rat cerebral and cerebellar cortex and thyme enhances the antioxidant defense system: histological, immunohistochemical and ultrastructural study. Int J Sci Rep 2018;4:124.
crossref pdf
36. Mao J, Sung B, Ji RR, Lim G. Neuronal apoptosis associated with morphine tolerance: evidence for an opioid-induced neurotoxic mechanism. J Neurosci 2002;22:7650-61.
crossref pmid pmc
37. Khodeary M, Sharaf El-Din A, El Kholy S. A histopathological and immunohistochemical study of adult rats’ brain after long-term exposure to amadol (tramadol hydrochloride). Mansoura J Forensic Med Clin Toxicol 2010;18:1-24.
crossref
38. Mohamed TM, Ghaffar HM, El Husseiny RM. Effects of tramadol, clonazepam, and their combination on brain mitochondrial complexes. Toxicol Ind Health 2015;31:1325-33.
crossref pmid pdf
39. Mohamed HM, Mahmoud AM. Chronic exposure to the opioid tramadol induces oxidative damage, inflammation and apoptosis, and alters cerebral monoamine neurotransmitters in rats. Biomed Pharmacother 2019;110:239-47.
crossref pmid
40. Hussein SA, Abdel Aal SA, Ismail HK. Effect of tramadol drug on some biochemical and immunological parameters in albino male rats; evaluation of possible reversal following its withdrawal. Benha Vet Med J 2017;33:418-29.
crossref
41. Elwy AEHM, Tabl G. Effects of chronic usage of tramadol, acetaminophen and tramacet on some biochemical and immunological changes in male rats. J Drug Res Egypt 2014;35:63-71.

42. Sacerdote P, Bianchi M, Manfredi B, Panerai AE. Effects of tramadol on immune responses and nociceptive thresholds in mice. Pain 1997;72:325-30.
crossref pmid
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 1 Web of Science
  • 1 Crossref
  • 1 Scopus
  • 3,374 View
  • 54 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next