The role of nGPx4 in resisting DEHP-induced DNA damage and reducing caspase‐independent cell death in male germ cells

Article information

Clin Exp Reprod Med. 2026;53(1):77-96
Publication date (electronic) : 2025 August 7
doi : https://doi.org/10.5653/cerm.2024.07521
1Department of Urology, Minda Hospital of Hubei Minzu University, Enshi, China
2Hubei Provincial Key Laboratory of Occurrence and Intervention of Rheumatic Diseases, Minda Hospital of Hubei Minzu University, Enshi, China
3Medical School, Hubei Minzu University, Enshi, China
4Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
5Institute of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
Corresponding author: Weilin Mao Department of Urology, Minda Hospital of Hubei Minzu University, Tuqiao Avenue Wufengshan Road No.2, Enshi, China Tel: +86-13479937699 Fax: +86-718-8247245 E-mail: 13479937699@163.com
Received 2024 September 24; Revised 2025 February 18; Accepted 2025 February 27.

Abstract

Objective

Di(2-ethyl-hexyl) phthalate (DEHP) is a widely used plasticizer that adversely affects sperm quality and function by inducing DNA damage and caspase-independent cell death (CICD). Nuclear glutathione peroxidase 4 (nGPx4) has been implicated in maintaining the structural integrity of sperm chromatin. However, it remains unclear whether nGPx4 can counteract the DNA damage caused by DEHP exposure.

Methods

We employed a germ cell line (GC-1) spg mouse cell model engineered to overexpress nGPx4 (OE-nGPx4). The cells were subsequently exposed to DEHP and its metabolite mono-2-ethylhexyl phthalate (MEHP) to simulate the DNA-damaging effects of environmental factors on reproductive cells. Following treatment, we assessed the proportion of apoptotic cells and the extent of DNA damage using molecular biological analyses, in addition to evaluating the expression of proteins associated with the apoptotic pathway in germ cells.

Results

nGPx4 overexpression protected against DEHP-induced DNA damage in germ cells, reducing the incidence of CICD and potentially preserving sperm quality. This protective effect was mediated by enhanced chromatin condensation in mouse sperm cells and downregulation of phosphorylated H2A histone variant (γ-H2A.X). The reduction in DNA degradation is attributed to a diminished formation of the complex between γ-H2A.X and apoptosis-inducing factor (AIF), resulting in decreased DNA fragmentation. Additionally, compared to MEHP-treated cells, OE-nGPx4 cells exhibited reduced expression of Bcl 2-associated X (Bax), thereby diminishing activation of the γ-H2A.X/AIF axis.

Conclusion

Our findings suggest that nGPx4 is involved in chromatin condensation and may contribute to downregulating the AIF/γ-H2A.X axis in male germ cells, ultimately reducing DNA damage-induced CICD.

Introduction

Spermatogenesis in mammals is an intricate process in which the genome's integrity is maintained through DNA damage repair mechanisms [1]. The transformation from spermatogonial cells to mature sperm is prone to DNA damage from various factors [2], which can lead to sperm impairment or apoptosis [3]. Thus, understanding the DNA-level factors and mechanisms that prevent sperm apoptosis is essential for improving sperm quality.

Di(2-ethyl-hexyl) phthalate (DEHP), extensively used as a plasticizer in the modern plastics industry, has been identified as an environmental endocrine-disrupting chemical following the detection of its metabolite mono-2-ethylhexyl phthalate (MEHP) in the human body [4]. Its widespread environmental contamination exposes humans to significant health risks. In addition to environmental impact, DEHP can trigger phthalate syndrome, which is characterized by the detachment of male germ cells, underdevelopment of the testes, and apoptosis of testicular support cells [5,6]. A mechanism underlying this syndrome is sperm DNA damage [7]. Disruption of sperm DNA integrity can induce germ cell apoptosis, thereby reducing sperm quality [8,9], leading to lower fertilization rates, poor embryo quality, and other reproductive defects [10], as well as a range of paternal genetic issues [11].

Glutathione peroxidase 4 (GPx4) is an essential selenoprotein that exists in three subtypes based on its intracellular localization and N-terminal sequence. One subtype, nuclear glutathione peroxidase 4 (nGPx4), plays a key role in condensing and stabilizing sperm chromatin [12,13] . Furthermore, nGPx4 coexists with protamines in the nucleus, contributing to chromatin stability [14,15], which aids in the formation of disulfide bridges among protamines, and covalently binds to DNA, promoting chromatin condensation [13,16-18]. This process reinforces the structural integrity of sperm chromatin and protects DNA from environmental stressors [14,19]. In response to extensive DEHP-induced DNA damage, Bcl 2-associated X (Bax) activates mitochondrial apoptosis-inducing factor (AIF) [20]. AIF then translocates to the nucleus and binds to phosphorylated H2A histone variant (γ-H2A.X) to initiate caspase-independent programmed cell death (PCD), also known as caspase-independent cell death (CICD) [21]. In addition to the established relationship between nGPx4 and the condensation of sperm chromatin, chromatin condenses further during spermatogenesis, accompanied by the loss of a significant portion of the cytoplasm [22,23]. Therefore, sperm cells differ from somatic cells in many DNA repair mechanisms [24]. No research has elucidated whether the synergistic actions of nGPx4 and protamines, which confer a highly condensed chromatin structure to sperm, can protect against DNA damage induced by DEHP exposure before damage occurs, specifically by inhibiting the activation of the γ-H2A.X/AIF axis. Thus, investigating the association between nGPx4 and DEHP-related male reproductive health, along with the protective mechanisms against DEHP-induced DNA damage, is imperative.

In this study, we constructed a lentiviral vector to overexpress nGPx4 (OE-nGPx4) and evaluated its effects on the mouse spermatogonial cell line germ cell line (GC-1) spg as well as on mouse testes. The objective was to determine whether nGPx4 overexpression can effectively counteract DNA damage mediated by the activation of the γ-H2A.X/AIF axis induced by DEHP and its metabolite MEHP, thereby identifying a potential target for enhancing male fertility.

Methods

1. Cell culture and construction of nGPx4-overexpressing GC-1 spg cells

The GC-1 spg cell line was procured from the Chinese Academy of Sciences Cell Bank and maintained in culture medium containing 10% fetal bovine serum, supplemented with streptomycin (0.1 mg/mL) and penicillin (100 I.U./mL) under standard conditions (37 °C with 5% CO₂). To OE-nGPx4, a lentiviral vector expressing green fluorescent protein-tagged nGPx4 (OE-GFP-nGPx4) was used, acquired from Shanghai Jikai Gene Chemical Co. Ltd. (sequence NM_001037741.4). GC-1 spg cells were transfected with the OE-nGPx4 lentivirus for 48 hours, while control cells were transfected with an empty vector (negative control [NC] group). The fluorescence signal was then assessed, and stably transfected cells were selected using puromycin (BL528A; Biosharp) for subsequent experiments.

1) Construction of a cellular model for MEHP-induced injury

To establish an in vitro GC-1 cell injury model, MEHP (796832; Merck KGaA Darmstadt) was dissolved in dimethyl sulfoxide (DMSO) (PYG0040; Boster) and used to induce DNA damage. MEHP was directly added to the culture medium, while control cells received only DMSO. The optimal concentration of MEHP was determined using the cell counting kit-8 (CCK-8, 40203ES80; Yeasen). GC-1 cells were seeded in a 96-well plate at a density of 3×10³ cells per well. After cell adhesion, MEHP was added at concentrations of 0, 50, 100, 200, 400, and 800 μM. Following a 48-hour incubation at 37 °C with 5% CO₂, cell proliferation was assessed using CCK-8 assays.

2. Animal experiments

1) Construction of a mouse model with testicular nGPx4 gene overexpression and DEHP - induced DNA damage

Twenty male C57BL/6 mice, aged 28 to 30 days and weighing 21 to 30 g, were housed at the Experimental Animal Center of Tongji Hospital. This study was approved by the Institutional Animal Care and Use Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, and all procedures adhered to established guidelines for laboratory animal care (approval no. SCXK(e)20230086). The mice were randomly divided into four groups (five animals per group): a sham operation group with corn oil gavage (wild-type [WT] group); a sham operation group with DEHP gavage (DEHP group, using DEHP [36735; Merck KGaA Darmstadt]); a group receiving testicular microinjection of lentivirus overexpressing nGPx4 combined with DEHP gavage (nGPx4 group); and a group receiving control virus injection with DEHP gavage (NC group). DEHP was dissolved in corn oil (C116023; Aladdin) and administered via gavage at a dose of 500 mg/kg/day, as recommended by Zhang et al. [25], to induce testicular DNA damage. Treatment continued for 28 days under specific pathogen free conditions, with mice having ad libitum access to food and water, followed by an additional 28 days of observation. After 28 days, all mice were sacrificed; testes and epididymides were collected. Right tissue samples were rapidly frozen in liquid nitrogen and stored at −80 °C for Western blot and real-time fluorescence quantitative polymerase chain reaction (qPCR) analyses, while left tissues were used for subsequent experiments, including chromomycin A3 (CMA3) and acridine orange (AO) staining.

3. Sperm sample collection and culture medium preparation

After weighing, the mice were anesthetized with 1% pentobarbital sodium, and their testes and epididymides were collected, with surrounding adipose tissue removed. The samples were rinsed in physiological saline and weighed. The tissues were then immediately placed in 1 mL of prewarmed M2 culture medium (M7167; Merck KGaA Darmstadt) at 37 °C. Multiple incisions were made in the testes and epididymides, and the tissues were incubated in a 37 °C water bath for 5 minutes, allowing sperm to swim out until the medium became visibly turbid.

4. Sperm quality analysis

1) Sperm counting

A 10 μL aliquot of testicular sperm suspension was loaded onto a hemocytometer (0.1 mm³), and the average number of sperm in the four corner squares (n) was counted using a standard optical microscope (Soptop) at 400× magnification. The total sperm count in 1 mL (1,000 mm³) of suspension was calculated as 10,000n.

2) Sperm motility rate assessment

The epididymal sperm suspension was evenly distributed on a glass slide. Under a standard optical microscope at 400× magnification, overall sperm motility was evaluated; any observed movement was considered motile [26]. Five fields of view were observed for each semen sample, and the total sperm motility rate was calculated as follows: motile sperm/total sperm count×100%.

3) Sperm morphology assessment

Approximately 50 μL of sperm suspension was placed on a microscope slide to evaluate sperm morphology. The sample was stained with a Diff-Quick stain kit (G1540; Solarbio), air-dried, and rinsed with water. Using an optical microscope (Carl Zeiss), cells from different fields were counted. Sperm morphology was evaluated according to established methods [27], with abnormalities classified into head, midpiece, and tail defects. For each group, at least three samples were analyzed, and at least 100 sperm were observed per sample. The percentage of abnormal sperm was calculated as (abnormal sperm/total sperm count)×100%.

5. Histopathology and immunohistochemistry staining

Testes and epididymides from three randomly selected mice per group were fixed with tissue fixative and processed for hematoxylin and eosin (H&E) staining for histopathological analysis. Following wax embedding and rinsing in water, sections were pre-stained with a hematoxylin and eosin solution, then stained with H&E (G1076; Servicebio), dehydrated, and mounted. For histological evaluation of the epididymis, transverse sections of the caput segment were chosen. Observations were performed under a light microscope, and histopathological scoring was conducted on 10 fields of view at 400× magnification according to Johnsen's criteria [28]. Parameters including epithelial cell height, luminal diameter, and renal tubule diameter were measured using ImageJ software (National Institutes of Health). The expression of nGPx4 in the testes and epididymis was determined by immunohistochemical staining using a mouse anti-GPx4 antibody (1:100, BM5231; Boster). Images were captured via microscopy and quantitatively analyzed with ImageJ.

6. Cell viability assay

For the cell viability assay, 1,000 cells per well were seeded in a 96-well plate. After MEHP treatment at 0, 24, and 48 hours, the medium was replaced with 100 μL of fresh culture medium, and 10 μL of CCK-8 reagent was added to each well. The GC-1 cells were then incubated at 37 °C for 2 hours, after which optical density was measured at 450 nm using a microplate reader. Results were normalized against control wells to account for variability. To assess cell proliferation, a BeyoClick 5-ethynyl-2′-deoxyuridine (EdU) cell proliferation kit with Alexa Fluor 594 (C0078S; Beyotime) was employed. Following phosphate buffered saline (PBS) washes, cells were incubated with an EdU solution for 2 hours, then nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) solution (G1401; Beyotime), and the cells were mounted for microscopic examination.

7. Apoptosis

Apoptosis was evaluated using an Annexin Allophycocyanin-conjugated Annexin V/7-aminoactinomycin D (Annexin V-APC/7-AAD) apoptosis detection kit (E-CK-A218B; Elabscience). Following 48 hours of treatment, GC-1 cells were resuspended, washed, centrifuged, and then resuspended in 500 μL of 1×Annexin V binding buffer. Next, 5 μL each of Annexin V-APC and 7-AAD reagents were added, and the cells were mixed and incubated in the dark at room temperature for 20 minutes. Apoptosis was then assessed using flow cytometry (Agilent).

8. Western blot analysis

GC-1 cells and mouse testicular tissues were digested and lysed in radioimmunoprecipitation assay (RIPA) buffer (AR0105; Boster) containing protease inhibitors (AR1182; Servicebio) for 30 minutes to extract proteins, including AIF, γ-H2A.X, caspase-3, Bax, and B-cell lymphoma 2 (Bcl-2). nGPx4 and truncated AIF (tAIF) were isolated using a cytoplasmic and nuclear separation kit (AR0106; Boster). Proteins were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (IPVH00010; Merck). The membranes were blocked with a rapid protein-free blocking solution (AR0041; Boster) and sequentially incubated with primary and secondary antibodies, followed by treatment with an enhanced chemiluminescence (ECL) reagent (G1212; Servicebio) and exposure using a luminescent imaging system (Bio-Rad). Band intensities were quantified using ImageJ. A list of all antibodies used is provided in Table 1.

Antibodies used for Western blotting

9. Co-immunoprecipitation analysis

Cells were lysed using the Biolinkedin Co-Immunoprecipitation Kit (IK-1004; Biolinkedin), and the protein lysate was divided into three aliquots. Each aliquot was incubated overnight at 4 °C with protein A/G magnetic beads and either the target protein antibody or an immunoglobulin G (IgG) control antibody. The supernatant was collected by removing the magnetic beads with a magnetic stand. Proteins from each aliquot were denatured by adding 1×SDS loading buffer, followed by electrophoresis and transfer to a membrane. After exposure, the proteins were quantified and identified.

10. Quantitative reverse transcription-PCR

Quantitative reverse transcription-PCR (qRT-PCR) was performed to assess mRNA levels of nGPx4, γ-H2A.X, caspase-3, Bax, and Bcl-2. Total RNA was extracted from GC-1 cells and mouse testicular tissue using a cell/tissue total RNA isolation kit (RC112; Vazyme) according to the manufacturer’s instructions. cDNA was synthesized using the 5×HiScript II qRT SuperMix Kit (R222; Vazyme). qPCR was then performed using 2×Taq Pro Universal SYBR Green/ROX qPCR Mix (Q712; Vazyme) on the QuantStudio 3 system (Thermo Fisher). Relative expression levels were calculated using the 2-ΔΔCT method with β-actin as the reference gene. PCR primer sequences are listed in Table 2.

Primers used for quantitative polymerase chain reaction

11. Immunofluorescence staining

Cells were fixed with 4% paraformaldehyde and permeabilized with PBS containing 0.5% Triton X-100 (T8200; Solarbio). Nonspecific antibody binding was blocked using a specific blocking solution (G2010L; Servicebio). Primary antibodies against GPx4 (1:100, BM5231; Boster), γ-H2AX (1:200, AP0687; ABclonal), and AIF (1:100, A2568; ABclonal) were applied. For mouse testicular and epididymal tissue sections, after deparaffinization, heat-induced antigen retrieval and serum blocking were performed. Sections were then incubated overnight at 4 °C with primary antibodies specific for γ-H2A.X, followed by incubation with a Cy3-labeled secondary antibody (1:50, GB21404; Servicebio) at room temperature for 1 hour. Nuclei were stained with DAPI, and images were captured using a laser microscope (Carl Zeiss). Fluorescence intensity was quantified using ImageJ.

12. CMA3 staining

CMA3 staining was performed using a flow cytometry-based quantitative method. CMA3 (HY-W040129; MCE) was dissolved in a solution comprising 17 mL of 0.1 M McIlvaine buffer (citric acid) combined with 83 mL of 0.2 M disodium hydrogen phosphate and 10 mM magnesium chloride (0.25 mg/mL). Spermatozoa were incubated in the CMA3/McIlvaine buffer at 25 °C in the dark for 20 minutes. Following incubation, samples were washed with PBS and sonicated on ice to separate sperm heads from tails. Each sample was then analyzed by flow cytometry, with a minimum of 10,000 spermatozoa evaluated per sample.

13. Sperm chromatin structure analysis

Sperm chromatin structure analysis (SCSA) was utilized to evaluate DNA fragmentation, in accordance with the most recent recommended guidelines [29]. After sperm quality assessment, samples were prepared similarly to the CMA3 staining protocol, with 300 μL of sperm suspension collected from various regions. Samples were centrifuged at 1,400 rpm for 5 minutes, after which 100 μL of AO staining solution (HY-101879; MCE) was added and the samples incubated in the dark for 20 minutes. Following a second centrifugation at 1,400 rpm for 5 minutes, the supernatant was discarded and the pellet resuspended in PBS. Sonication on ice was performed to separate sperm heads from tails, and the samples were analyzed by flow cytometry, with at least 10,000 sperm cells counted per sample. Results were evaluated using conventional scoring methods for the DNA fragmentation index (DFI) and high-intensity DNA staining (HDS); under these conditions, AO intercalated with double-stranded DNA emits green fluorescence, whereas AO bound to single-stranded DNA emits red fluorescence.

14. TUNEL assay

Apoptotic cells were detected using a terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) apoptosis assay kit (GDP1042; Servicebio). Mouse testicular and epididymal tissue sections underwent deparaffinization, hydration, and membrane permeabilization, then were incubated with a TUNEL reaction mixture (containing TDT enzyme, dUTP, and reaction buffer) at 37 °C for 2 hours. Following nuclei staining with DAPI, sections were observed and photographed under a microscope, and TUNEL fluorescence intensity was quantitatively analyzed using ImageJ.

15. RNA sequencing analysis

Following MEHP treatment, total RNA was extracted using RNAiso Plus. mRNA sequencing was performed with three replicates per group on the DNBSEQ-T7-PE150 platform at SpecAlly Life Technology. Differential expression analysis was conducted using the R packages edgeR (R Foundation for Statistical Computing) or DESeq2 to identify differentially expressed genes (DEGs) [30]. Functional analysis of DEGs was carried out using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, and gene set enrichment analysis (GSEA) was performed using the clusterProfiler package in R [31].

16. Statistical analysis

Data are presented as mean±standard deviation and analyzed using GraphPad Prism ver. 10.1 (GraphPad Software). For normally distributed quantitative data, one-way analysis of variance (ANOVA) was used to compare differences among multiple groups with a single independent variable, while two-way ANOVA was employed for comparisons involving two independent variables. Post hoc analysis was conducted using Tukey’s test for multiple comparisons. Statistical significance was defined as p<0.05; significance levels are indicated as follows: p<0.05, p<0.01, p<0.001, and p<0.0001.

Results

1. nGPx4 overexpression with a lentiviral vector increases GC1-spg cell proliferation

Immunofluorescence staining, qPCR, and Western blot analyses (Figure 1) confirmed that the nGPx4 expression level was significantly higher in the overexpression group than in the control group (p<0.001), indicating successful nGPx4 protein overexpression. Based on the MEHP concentration gradient experiment (Figure 2A), a concentration of 400 µg/µL MEHP was selected. At this concentration, cells exhibited an appropriate damage ratio (75.2%) relative to controls, with overlapping cell states. Following a 48-hour treatment with this MEHP concentration, the CCK-8/EdU cell proliferation assay (Figure 2B, 2C) revealed that the proliferation changes induced by nGPx4 overexpression were dependent on the duration of MEHP exposure, with cells in the nGPx4 group exhibiting significantly greater activity at 48 hours (p<0.001).

Figure 1.

Results of nuclear glutathione peroxidase 4 (nGPx4) overexpression via lentiviral infection. (A) Quantification of immunofluorescence staining for nGPx4 protein expression, with the target protein shown in red, transfected viral cells in green, and nuclei counterstained with 4′,6-diamidino-2-phenylindole (DAPI) in blue. (B) Quantitative polymerase chain reaction results for nGPx4. (C) Western blot analysis of nGPx4 protein levels. Image analysis was performed using ImageJ, and the data are presented as mean±standard deviation. Scale bar: 20 µm. GC-1, germ cell line; NC, negative control; DMSO, dimethyl sulfoxide; MEHP, mono-2-ethylhexyl phthalate; GFP, green fluorescent protein. a)p<0.001; b)p<0.0001 compared with the control group.

Figure 2.

The effect of nuclear glutathione peroxidase 4 (nGPx4) overexpression on germ cell line (GC-1) spg cell proliferation and apoptosis after mono-2-ethylhexyl phthalate (MEHP) exposure. (A) cell counting kit-8 (CCK-8) assay results for the MEHP concentration gradient, showing significant differences between the nGPx4 and GC-1 groups (p<0.05) and highly significant differences between the GC-1/nGPx4 and negative control (NC) groups (p<0.0001) as well as between the nGPx4 and NC groups (p<0.0001). (B, C) CCK-8/5-ethynyl-2′-deoxyuridine (EdU) assay results demonstrating the influence of nGPx4 on cell proliferation at various time points following MEHP exposure, with highly significant differences between the GC-1+MEHP and NC+MEHP groups compared with the nGPx4+MEHP group (p<0.0001) and a significant difference between the GC-1+MEHP and nGPx4+MEHP groups (p<0.001). Images were analyzed using ImageJ, and data are presented as mean±standard deviation. Scale bar: 50 µm. ns, not significant; DMSO, dimethyl sulfoxide; DAPI, 4′,6-diamidino-2-phenylindole. a)Not significant differences between the GC-1/nGPx4; b)Not significant differences between the GC-1/NC groups; c),d)Highly significant differences between the GC-1/NC groups; e)Highly significant differences between the nGPx4/NC groups; f)p<0.001; g)p<0.0001 compared with the control group.

2. Lentivirus-mediated overexpression of nGPX4 counteracts MEHP-induced DNA damage and apoptosis in GC1-spg cells

Experiments evaluated key proteins involved in the apoptotic pathway in MEHP-induced GC-1 cell injury. qPCR and Western blot analyses for caspase-3 (Figure 3A, 3B, 3E) revealed lower expression in the nGPx4 group compared to the GC-1 group. Cleaved caspase-3 also showed a downward trend relative to the MEHP-treated GC-1 group. Concurrently, Figure 3C and 3E demonstrates an increase in the antiapoptotic protein Bcl-2 and a decrease in Bax levels in nGPx4-overexpressing cells, further confirming the protective effect of nGPx4 overexpression on apoptosis. Moreover, even after MEHP exposure, both the protein and mRNA levels of the DNA double-strand break marker γ-H2A.X were significantly reduced in the nGPx4-overexpressing group, a finding corroborated by immunofluorescence results (Figure 3D, 3F).

Figure 3.

Effects of nuclear glutathione peroxidase 4 (nGPx4) overexpression on DNA damage and apoptosis-related protein expression in germ cell line (GC-1) spg cells after mono-2-ethylhexyl phthalate (MEHP) exposure. Quantitative analysis of mRNA expression levels of (A) phosphorylated H2A histone variant (γ-H2A.X), (B) Caspase-3, (C) Bcl 2-associated X (Bax), and (D) B-cell lymphoma 2 (Bcl-2), demonstrating MEHP’s impact on these genes. (E) Western blot analysis of apoptosis-related proteins. (F) Quantitative immunofluorescence analysis of the DNA damage marker γ-H2A.X. Image analysis was performed using ImageJ, and the data are presented as mean±standard deviation. Scale bar: 20 µm. ns, not significant; NC, negative control; DMSO, dimethyl sulfoxide; DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 compared with the control group.

3. Role of nGPx4 overexpression in reducing the formation of the tAIF/γ-H2AX active DNA degradation complex

Experiments demonstrated that MEHP exposure significantly increased DNA damage in GC-1 spg cells, and no significant difference was observed in the AIF group that achieved overexpression of nGPx4 (Figure 4F), but the γ-H2A.X in this group showed a clear down-regulation trend (Figure 4A-4C). We then investigated the behavior of AIF and γ-H2A.X following MEHP treatment. Activated by Bax, AIF translocated from the mitochondria to the nucleus to form the active tAIF (Figure 4D). AIF interacts with phosphorylated H2A.X (γ - H2A.X) to form an active DNA degradation complex, triggering chromatin dissolution. This was confirmed by co-immunoprecipitation experiments [32]. As anticipated, lysates from cells with induced DNA damage showed co-immunoprecipitation of AIF and γ-H2A.X using an anti-AIF antibody (Figure 4E). Although attempts to co-immunoprecipitate nGPx4 and γ-H2A.X did not reveal a direct interaction, the downregulation of γ-H2A.X likely weakened the formation of the degradation complex, thereby reducing DNA degradation. Finally, the changes in apoptotic protein expression were consistent with the flow cytometry results (Figure 4G, 4H). The OE-nGPx4 group showed a significantly lower apoptosis rate (p<0.0001).

Figure 4.

Impact of nuclear glutathione peroxidase 4 (nGPx4) overexpression on truncated apoptosis-inducing factor (tAIF)/phosphorylated H2A histone variant (γ-H2A.X) axis activation and apoptosis in germ cell line (GC-1) spg cells following mono-2-ethylhexyl phthalate (MEHP) exposure. (A) Western blot analysis of AIF and γ-H2A.X protein expression. (B) Quantitative immunofluorescence analysis of the DNA damage marker AIF. (C) Expression of nGPx4. (D) Translocation of AIF from the cytoplasm to the nucleus. (E) Immunoprecipitation analysis from MEHP-treated and untreated groups using anti-γ-H2A.X/anti-immunoglobulin G (IgG) antibodies. (F) Quantitative mRNA expression analysis of nGPx4, AIF, and γ-H2A.X. (G, H) Flow cytometry analysis of apoptotic GC-1 cells following MEHP exposure. Data were analyzed using ImageJ and are expressed as mean±standard deviation. Scale bar: 20 µm. OE, overexpress; NC, negative control; IP, immunoprecipitation; IB, immunoblotting; DMSO, dimethyl sulfoxide; DAPI, 4′,6-diamidino-2-phenylindole; ns, not significant; 7-AAD, 7-aminoactinomycin D; APC, allophycocyanin-conjugated. a)p<0.01; b)p<0.001; c)p<0.0001 compared with the control group.

4. DEG analysis and KEGG pathway analysis of GC-1 cells treated with MEHP

We performed RNA-seq transcriptomic analysis on MEHP-treated cells to further elucidate the mechanisms by which nGPx4 alleviates apoptosis in GC-1 spg cells. Initially, principal component analysis plots comparing the three MEHP-treated groups revealed no significant intragroup differences (Figure 5A). Further analysis identified 3,594 DEGs, with 1,636 downregulated and 1,958 upregulated (Figure 5B). Subsequently, a comprehensive GO enrichment analysis and KEGG pathway enrichment analysis were performed on all DEGs to clarify their functional attributes. Among the top 10 pathways, aside from those related to chromatin structural constituents, pathways such as ‘protein localization to centromere protein A (CENP-A) containing chromatin’ were significantly overrepresented (Figure 5C, 5D). Moreover, GSEA plots revealed that in the OE-nGPx4 group, the ‘DNA packaging complex’ and ‘condensed chromosome’ pathways were upregulated (Figure 5E5H).

Figure 5.

RNA-seq analysis of mono-2-ethylhexyl phthalate (MEHP)-treated cells. (A) Heatmap of differentially expressed genes between the germ cell line (GC-1) group and the nuclear glutathione peroxidase 4 (nGPx4)/negative control (NC) group. (B) Differential gene expression between the NC and nGPx4 groups. (C, D) Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of differentially expressed genes. (E, F, G, H) Gene set enrichment analysis of related pathways. Data are expressed as mean±standard deviation. CENP-A, centromere protein A; PPAR, peroxisome proliferator-activated receptor.

5. nGPx4 overexpression attenuates the effects of DEHP exposure on mouse sperm quality

To investigate the toxicological effects of nGPx4 overexpression in countering DEHP-induced sperm DNA damage, nGPx4 was overexpressed in mice (Figure 6A, 6B, 6D) and a DEHP exposure mouse model was established. All experimental mice were weighed, and as shown in Figure 6C, no significant difference in body weight was observed between DEHP-exposed mice and those receiving sham gavage (p>0.05). However, the testicular organ coefficient in the DEHP, nGPx4, and NC groups was significantly lower than that in the control group (p<0.05), whereas the epididymal organ coefficient showed no significant difference (p>0.05), consistent with DEHP’s primary toxic effects on the testes (Figure 6E, 6F). Furthermore, sperm quality indicators—including sperm count, total motility rate, and morphology—were adversely affected by DEHP exposure (Figure 6G, 6H). Specifically, sperm count in all three DEHP-treated groups was significantly lower than that in WT mice (p<0.05). Similar trends were observed in total motility and abnormality rates, with the most pronounced reduction in motility seen in the NC group following DEHP cotreatment (p<0.01). Compared with WT mice (Figure 6I), DEHP-exposed mice exhibited more structural sperm abnormalities, with the highest abnormality rate in the NC+DEHP group, while the nGPx4 group showed fewer abnormalities. Although no significant difference in the abnormality rate was observed between the nGPx4+DEHP and WT groups, the NC+DEHP group had a significant reduction in the number of abnormal sperm.

Figure 6.

(A) Quantitative analysis of nuclear glutathione peroxidase 4 (nGPx4) mRNA. (B) Western blot analysis of nGPx4. (C) Mouse body weight. (D) Representative immunohistochemistry staining image for nGPx4. (E, F) Testis and epididymis coefficients. (G, H) Mouse sperm count and total motility rate. (I) Representative images of mouse sperm morphology. Green arrows indicate normal sperm morphology; red arrows denote head abnormalities; and orange and yellow arrows represent midpiece abnormalities. Data are presented as mean±standard deviation. Scale bar: 50 µm. WT, wild-type; DEHP, di(2-ethyl-hexyl) phthalate; NC, negative control; ns, not significant. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 compared with the control group.

The histological sections depicted in Figure 7 revealed distinct pathological alterations following DEHP exposure compared to the WT group. Notably, the thinning of the seminiferous tubule lumen was accompanied by the emergence of fissures or vacuoles and a marked decrease in the number of germ cells at various developmental stages within the basal layer. Sperm alignment was disrupted, with instances of sperm cells irregularly present within the germinative layer. Furthermore, the interstitial spaces among the testicular seminiferous tubules were wider than those in the WT group. The epididymal tubules post-DEHP exposure were characterized by a reduction in the sperm cell count, disorganized arrangement, and the presence of sloughing germ cells at different stages, with occasional vacuolation observable within the tubular lumens. Compared with the NC group, the nGPx4 group presented no significant pathological disparities when juxtaposed with the DEHP group; however, the nGPx4 group exhibited a reduced presence of pathological features.

Figure 7.

Hematoxylin and eosin (H&E) staining of mouse testicular seminiferous tubules (A) and epididymides (B). Blue arrows indicate spermatogonia (SG); red arrows, primary spermatocytes (PS); orange arrows, round spermatids (RS); and green arrows, elongated spermatids (ES). White short arrows denote vacuoles and cracks; black short arrows indicate thinning of seminiferous tubules; green short arrows mark abnormal sperm distribution; white long arrows denote sloughing germ cells; and black long arrows indicate vacuolation of the tubule lumen. Scale bars: 20 and 50 µm. WT, wild-type; DEHP, di(2-ethyl-hexyl) phthalate; nGPx4, nuclear glutathione peroxidase 4; NC, negative control.

6. nGPx4 overexpression attenuates the impact of DEHP exposure on the sperm chromatin structure

Experiments first analyzed the DNA damage marker γ-H2A.X via mRNA extraction to assess the effects of DEHP exposure on sperm DNA integrity (Figure 8A). The expression of γ-H2A.X in the DEHP and NC+DEHP groups was significantly higher than in the WT and nGPx4+DEHP groups. Moreover, In addition, Western blot of γ-H2A.X, as well as immunofluorescence staining results (Figure 8B8D), showed that DEHP treatment induced significant DNA damage in mouse spermatocytes, while nGPx4 overexpression reduced this damage. To further elucidate chromatin structural changes, we performed CMA3 and AO staining (Figure 8E8H). Compared with the WT group, AO positivity rates were significantly higher in DEHP-exposed sperm samples (p<0.0001), reflecting an increased proportion of HDS and DFI (Figure 8I). In contrast, the percentage of AO-stained sperm in the nGPx4+DEHP group was significantly lower than in the other DEHP groups (p<0.0001), indicating reduced chromatin damage. The CMA3 assay did not reveal a significant effect of nGPx4 treatment on DEHP-exposed sperm cells; although DEHP exposure resulted in decreased CMA3 positivity overall, the nGPx4 group exhibited a lower positivity rate than the coexposure NC group (p<0.0001).

Figure 8.

Flow cytometry analysis of acridine orange (AO) and chromomycin A3 (CMA3) data. (A) Western blot analysis of phosphorylated H2A histone variant (γ-H2A.X). (B, C) Immunofluorescence staining of γ-H2A.X in testis sections. (D) Quantitative mRNA expression analysis of γ-H2A.X. (E, F) AO orange fluorescence intensity. (G, H) CMA3 binding positivity rates. (I) Sperm chromatin status assessed by sperm chromatin structure analysis, showing DNA fragmentation index (DFI) and high DNA staining (HDS) percentages. Data are expressed as mean±standard deviation. Scale bar: 50 µm. ns, not significant; WT, wild-type; DEHP, di(2-ethyl-hexyl) phthalate; nGPx4, nuclear glutathione peroxidase 4; NC, negative control; DAPI, 4′,6-diamidino-2-phenylindole; PerCP-A, phycoerythrincy5.5; PE-A, phycoerythrin; FITC, fluorescein isothiocyanate. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 compared with the control group.

7. nGPx4 overexpression protects against the effects of DEHP exposure on mouse sperm apoptosis

To determine whether the observed changes resulted from increased sperm cell apoptosis, we performed TUNEL staining on testes and epididymis sections (Figure 9A9C). Compared with WT control mice, DEHP-exposed mice exhibited a significantly higher number of apoptotic germ cells (p<0.001). However, in groups treated with both nGPx4 and DEHP, there was a marked reduction in apoptotic cells compared with those exposed to DEHP alone (p<0.001). Although similar patterns were observed in the epididymal tubules, apoptosis was less pronounced in sperm cells compared to those in testicular seminiferous tubules. Additionally, qPCR and Western blot analyses for caspase-3 (Figure 9D, 9G-9I) showed that caspase-3 expression was higher in the nGPx4 group than in the DEHP-only group, yet lower than in the co-exposed NC group (p<0.0001). Notably, the levels of cleaved caspase-3 and Bax (Figure 9E, 9G-9I) were lower in the nGPx4 group than in the other DEHP-exposed groups. Furthermore, both qPCR and Western blot analyses revealed consistent upregulation of Bcl-2 expression in mouse sperm following nGPx4 overexpression (Figure 9F-9I), indicating that nGPx4 overexpression plays an antiapoptotic role in sperm cells.

Figure 9.

Analysis of apoptosis in germ cells from the testes and epididymis following di(2-ethyl-hexyl) phthalate (DEHP) exposure. (A, B, C) Representative terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining images of testes and epididymides; TUNEL (red) and 4′,6-diamidino-2-phenylindole (DAPI; blue). (D, E, F) Quantitative analysis of mRNA expression levels for caspase-3, Bcl 2-associated X (Bax), and B-cell lymphoma 2 (Bcl-2). (G, H, I) Western blot analysis of caspase-3, Bax, and Bcl-2 in testes after DEHP exposure. Image analysis was performed using ImageJ, and data are expressed as mean±standard deviation. Scale bars: 200 and 50 µm. WT, wild-type; nGPx4, nuclear glutathione peroxidase 4; NC, negative control; ns, not significant. a)p<0.01; b)p<0.001; c)p<0.0001 compared with the control group.

Discussion

The male reproductive system is frequently exposed to environmental factors that damage DNA, thereby increasing the risk of apoptosis in reproductive cells [33]. DEHP is one of the most significant agents of DNA damage, and its metabolite, mono-(2-ethylhexyl) phthalate (MEHP), is the primary substance affecting the body after DEHP exposure [34]. Elevated MEHP levels can induce oxidative stress, leading to increased sperm DNA damage and, ultimately, cell apoptosis [35]. DNA damage in reproductive cells is largely attributed to inadequate chromatin condensation during the transition from meiotic division to maturation in the epididymis. Sperm chromatin matures upon reaching the epididymis, where protamines form both intermolecular and intramolecular disulfide bonds [36,37]; if chromatin packaging is incomplete, sperm morphology, fertilization capacity, and resistance to DNA damage may be compromised [38]. Research suggests that nGPx4 may participate in the transformation of protamines [13]. Consequently, nGPx4 could play a crucial role in defending reproductive cells against DNA damage. This study utilized GC-1 cells and mouse models to simulate DEHP/MEHP exposure, induce sperm DNA damage, and assess the protective effect of nGPx4 overexpression on DNA damage and on the downregulation of γ-H2A.X, which affects the formation of the tAIF/γ-H2A.X complex, leading to DNA fragmentation and caspase-independent cell death (Figure 10).

Figure 10.

Di (2-ethyl-hexyl) phthalate (DEHP) exposure induces caspase-independent cell death in male mouse germ cells via the formation of the apoptosis-inducing factor (AIF)/phosphorylated H2A histone variant (γ-H2A.X) complex. After mice ingest DEHP, it is metabolized into mono-2-ethylhexyl phthalate (MEHP), which activates Bcl 2-associated X (Bax) to trigger the release of AIF from the mitochondria. The released truncated AIF (tAIF) translocates to the nucleus and forms a DNA degradation complex with γ-H2A.X/cyclophilin A (CypA), leading to DNA fragmentation. In severe cases, this process results in caspase-independent cell death. In contrast, nuclear glutathione peroxidase 4 (nGPx4) overexpression induces chromatin condensation and effectively downregulates γ-H2A.X expression, thereby mitigating caspase-independent cell death. Collectively, these mechanisms protect male mouse germ cells.

The results of this study demonstrated that, compared with control mice, DEHP-treated mice exhibited a notable decrease in testicular weight. This observation aligns with previous findings that DEHP’s toxic effects on the male reproductive system can cause testicular atrophy, as evidenced by reduced testicular weight [39]. Notably, the testicular organ coefficient of mice overexpressing nGPx4 was more favorable than that of mice treated with DEHP alone or in the NC group.

Testicular sperm count and epididymal sperm motility are crucial indicators of sperm quality. In our study, mice exposed to DEHP showed decreases in both total sperm count and motility compared with the control group, consistent with the findings of Bahrami et al. [40]. However, in the nGPx4+DEHP group, sperm count and motility were not significantly improved relative to the DEHP-only group. Furthermore, our research revealed that the DEHP group had a higher proportion of sperm with abnormal morphology compared with the WT group, likely due to compromised sperm DNA integrity caused by DEHP exposure [41]. In contrast, cotreatment with DEHP and nGPx4 overexpression reduced the incidence of sperm morphological abnormalities, suggesting that nGPx4 may mitigate the detrimental effects of DEHP on sperm DNA. Although sperm with more than 30% DNA damage are generally considered infertile [42], routine semen analyses might still classify these sperm as normal [43]. This discrepancy may account for the lack of significant differences in sperm quality between the DEHP-only group and the combined treatment group.

Studies have demonstrated that alterations in the condensation characteristics and physical structure of sperm chromatin can lead to reduced sperm count, abnormal morphology, and decreased motility [44], findings that are consistent with our experimental outcomes. Moreover, proper chromatin condensation plays a crucial role during the progression from spermatogenesis to sperm maturation, contributing to the distinctive morphological features of male sperm [45]. Although the basic structure of chromatin is established during the final stages of sperm meiotic division [46,47], condensation is not complete and continues to undergo subtle adjustments until the sperm reach the epididymis [27]. In the epididymis, nGPx4 interacts with protamines to reinforce chromatin structure through the formation of both intermolecular and intramolecular disulfide bonds [36,37]. Based on these findings and the role of chromatin condensation in sperm maturation, we hypothesize that nGPx4 functions as a regulatory protein in the condensation process, stabilizing chromatin structure and composition to enhance resistance against environmental stressors.

To further investigate this issue, we employed CMA3 staining and the SCSA to assess nuclear condensation and chromatin quality in mouse sperm. In the SCSA, we focused on three key parameters: overall AO positivity, HDS, and DFI. Following DEHP exposure, these parameters increased, whereas sperm from the nGPx4-overexpressing group exhibited a notably lower AO positivity rate than those from the other DEHP-exposed groups, suggesting reduced chromatin fragmentation and structural impairment. In contrast to the positive correlation between CMA3 positivity and DNA fragmentation reported by Ni et al. [48], our findings revealed that CMA3 positivity in DEHP-exposed groups was lower than in the WT group, implying a more condensed chromatin structure. This discrepancy with the AO assay results indicates that the relationship between CMA3 positivity and DNA damage is not straightforward. Amor, H reported similar observations and proposed that a high CMA3 positivity rate, indicating a relative lack of protamines, could increase vulnerability to DNA damage [49]. DNA damage may also result from oxidative stress increasing the number of DNA breaks within CMA3-binding regions, thereby hindering CMA3 dye binding [50], or from defects during spermatogenesis, such as in the histone-to-protamine transition [51]. In contrast to the study by Conrad et al. [13], which used nGPx4 gene knockout mice and reported no significant differences in spermatogonial cell proliferation or apoptosis, their methodology may not have detected subtle changes in chromatin condensation during sperm maturation under normal conditions without excessive DNA damage. In our DEHP/MEHP-induced DNA damage model, appropriate repair mechanisms may have been activated in certain regions [52]. Flow cytometry revealed a significant reduction in the percentage of apoptotic sperm cells in the nGPx4 overexpression group relative to the WT group. Additionally, the CCK-8/EdU cell viability assay demonstrated enhanced cellular activity in the OE-nGPx4 group after 48 hours. We propose that cells possess inherent repair mechanisms to counteract external DNA damage, including the expression of protamines, histones, and transition proteins that can compensate for one another during chromatin condensation [53,54]. This compensatory mechanism helps maintain cellular resistance [55], mitigating the impact of environmental stressors to a level that can be managed by repair systems in the body. This finding is in line with the experimental outcomes of researchers such as Conrad, who observed cells in a normal physiological state. However, extensive or sustained damage can overwhelm the cellular compensatory mechanisms, ultimately leading to PCD. The results of our research suggest that DEHP can damage sperm chromatin [56], and that DEHP/MEHP acts as a DNA-damaging agent that induces chromatin decondensation, which in turn enhances the capacity of CMA3 and AO staining to detect DNA structural abnormalities [57]. In cultured cells, we further explored the mechanism by which AIF enters the nucleus to induce DNA fragmentation; the complex formed by AIF and γ-H2A.X is critical in this process [58]. Although nGPx4 does not directly interact with AIF or γ-H2A.X, its overexpression effectively downregulates γ-H2A.X expression, thereby indirectly reducing the formation of the DNA degradation complex. This process prevents chromatin dissolution in germ cells and confers resistance to programmed necrosis [21]. Further evidence supports the positive role of nGPx4 in resisting DNA damage. Bax and caspase-3 play key roles in apoptosis activation, and although no significant difference in caspase-3 expression was observed, the overexpression of nGPx4 led to a notable downregulation of Bax expression, consistent with the activation of CICD. This finding aligns closely with the enrichment results from RNA-seq, which showed that exposure to DEHP/MEHP severely affected germ cell chromatin, and the overexpression of nGPx4 exhibited superior characteristics in chromatin structure packaging compared to the other treatments. In summary, under the toxic effects of DEHP/MEHP, nGPx4 may enhance sperm cell resistance by reducing CICD through its ability to counteract extensive DNA damage.

During spermatogenesis and sperm packaging in the epididymis, the presence of intense or sustained DNA-damaging factors such as DEHP can destabilize sperm chromatin. Under such conditions, nGPx4 may be activated to counteract this persistent DNA damage, thereby reducing the incidence of apoptosis in sperm cells. Furthermore, chromatin functions as a network and processing hub with defined roles, and recent findings indicate that fluctuations in protein concentration could be involved in the regulation of the cell cycle [59]. Hence, establishing more precise criteria for assessing sperm quality is imperative. Collectively, these results suggest that nGPx4 may have an additional role during spermatogenesis. By enhancing chromatin condensation, nGPx4 could protect sperm from DNA damage and reduce apoptosis. Within the subcellular nuclear compartments of sperm, nGPx4 may influence the expression of nucleoprotamines, subtly modulating their interaction with DNA. These findings support the notion that nGPx4 is a key epigenetic modulator in sperm cells.

This study used animal models to replicate and assess the effects of nGPx4 overexpression on sperm, providing a direct reflection and evaluation of how nGPx4 influences sperm chromatin condensation and its subsequent impact on sperm apoptosis. Nonetheless, there are several limitations that warrant further investigation. For example, research in animal models indicates that as sperm cells traverse the epididymal duct, other selenoenzymes might compensate for any deficiency in nGPx4 expression [13]. Additionally, the concentration of nGPX4 is significantly lower than that of the cytosolic/mitochondrial GPX4 isoforms, and nGPX4 is susceptible to proteolytic degradation into peptides of different lengths. Furthermore, the smaller cGPx4, capable of entering the nucleus, could compensate for the absence of nGPx4 in sperm [60,61]. Unfortunately, in our study, we did not validate our results through the generation of nGPx4 transgenic knockdown mice or the analysis of clinical samples. These limitations could constrain the interpretation of nGPx4 as an important player in the molecular mechanisms involved in sperm health and function.

In conclusion, our study revealed that nGPx4 plays a significant role in DNA condensation. By overexpressing nGPx4, we demonstrated its ability to effectively downregulate γ-H2AX expression under conditions of external damage. This downregulation reduces the formation of the tAIF/γ-H2A.X DNA degradation complex and mitigates DNA damage, thereby protecting sperm from non-caspase-mediated PCD. Although our findings are exploratory, they suggest that targeting nGPx4 may offer therapeutic approaches to counteract DEHP-induced damage. Continued research into the mechanisms by which these nuclear proteins regulate genomic stability will enhance our understanding of how reproductive cells transmit genetic information.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was funded by the Enshi Tujia and Miao Autonomous Prefecture Bureau of Science and Technology (grant number XYJ2020000061) and the Hubei Provincial Natural Science Foundation of China (grant number 2022CFB255).

We thank the members of Jihong Liu’s group for their advice on the experimental methods and the staff of the Animal Research Center of Tongji Hospital for their meticulous care of the animals. Figure 10 was Created in BioRender. Wang, J. (2025) https://BioRender.com/y10o509.

Author contributions

Conceptualization: WG, JW. Methodology: WG, JW, XL. Formal analysis: WG, JW, XL. Data curation: WG. Funding acquisition: ZZ, PR, QL, WM. Project administration: ZZ, PR, WM. Visualization: WG. Software: HT, HY. Validation: WG. Investigation: HT, HY. Writing-original draft: WG. Writing-review & editing: WG, WM. Approval of final manuscript: WG, JW, XL, HT, HY, ZZ, PR, QL, WM.

References

1. Li Y, Wu YF, Jiang HW, Khan R, Han QQ, Iqbal F, et al. The molecular control of meiotic double-strand break (DSB) formation and its significance in human infertility. Asian J Androl 2021;23:555–61. 10.4103/aja.aja_5_21. 33586697.
2. Dorostghoal M, Kazeminejad SR, Shahbazian N, Pourmehdi M, Jabbari A. Oxidative stress status and sperm DNA fragmentation in fertile and infertile men. Andrologia 2017;49:12762. 10.1111/and.12762. 28124476.
3. Gunes S, Al-Sadaan M, Agarwal A. Spermatogenesis, DNA damage and DNA repair mechanisms in male infertility. Reprod Biomed Online 2015;31:309–19. 10.1016/j.rbmo.2015.06.010. 26206278.
4. Halden RU. Plastics and health risks. Annu Rev Public Health 2010;31:179–94. 10.1146/annurev.publhealth.012809.103714. 20070188.
5. Wang YX, Zeng Q, Sun Y, You L, Wang P, Li M, et al. Phthalate exposure in association with serum hormone levels, sperm DNA damage and spermatozoa apoptosis: a cross-sectional study in China. Environ Res 2016;150:557–65. 10.1016/j.envres.2015.11.023. 26654563.
6. Mondal S, Ghosh S, Bhattacharya S, Mukherjee S. Chronic dietary administration of lower levels of diethyl phthalate induces murine testicular germ cell inflammation and sperm pathologies: involvement of oxidative stress. Chemosphere 2019;229:443–51. 10.1016/j.chemosphere.2019.05.017. 31085347.
7. Sumner RN, Tomlinson M, Craigon J, England GC, Lea RG. Independent and combined effects of diethylhexyl phthalate and polychlorinated biphenyl 153 on sperm quality in the human and dog. Sci Rep 2019;9:3409. 10.1038/s41598-019-39913-9. 30833626.
8. Palermo GD, Neri QV, Cozzubbo T, Rosenwaks Z. Perspectives on the assessment of human sperm chromatin integrity. Fertil Steril 2014;102:1508–17. 10.1016/j.fertnstert.2014.10.008. 25456796.
9. Gorczyca W, Gong J, Darzynkiewicz Z. Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Res 1993;53:1945–51. 8467513.
10. Soubry A. Epigenetic inheritance and evolution: a paternal perspective on dietary influences. Prog Biophys Mol Biol 2015;118:79–85. 10.1016/j.pbiomolbio.2015.02.008. 25769497.
11. Sengupta P, Dutta S, Liew FF, Dhawan V, Das B, Mottola F, et al. Environmental and genetic traffic in the journey from sperm to offspring. Biomolecules 2023;13:1759. 10.3390/biom13121759. 38136630.
12. Zhang Y, Liu J, Li X, Zhou G, Sang Y, Zhang M, et al. Dietary selenium excess affected spermatogenesis via DNA damage and telomere-related cell senescence and apoptosis in mice. Food Chem Toxicol 2023;171:113556. 10.1016/j.fct.2022.113556. 36502996.
13. Conrad M, Moreno SG, Sinowatz F, Ursini F, Kolle S, Roveri A, et al. The nuclear form of phospholipid hydroperoxide glutathione peroxidase is a protein thiol peroxidase contributing to sperm chromatin stability. Mol Cell Biol 2005;25:7637–44. 10.1128/mcb.25.17.7637-7644.2005. 16107710.
14. Steger K, Balhorn R. Sperm nuclear protamines: a checkpoint to control sperm chromatin quality. Anat Histol Embryol 2018;47:273–9. 10.1111/ahe.12361. 29797354.
15. Schneider S, Balbach M, Jikeli JF, Fietz D, Nettersheim D, Jostes S, et al. Re-visiting the protamine-2 locus: deletion, but not haploinsufficiency, renders male mice infertile. Sci Rep 2016;6:36764. 10.1038/srep36764. 27833122.
16. Balhorn R. The protamine family of sperm nuclear proteins. Genome Biol 2007;8:227. 10.1186/gb-2007-8-9-227. 17903313.
17. Ward WS, Coffey DS. DNA packaging and organization in mammalian spermatozoa: comparison with somatic cells. Biol Reprod 1991;44:569–74. 10.1095/biolreprod44.4.569. 2043729.
18. Noblanc A, Peltier M, Damon-Soubeyrand C, Kerchkove N, Chabory E, Vernet P, et al. Epididymis response partly compensates for spermatozoa oxidative defects in snGPx4 and GPx5 double mutant mice. PLoS One 2012;7e38565. 10.1371/journal.pone.0038565. 22719900.
19. Puglisi R, Maccari I, Pipolo S, Conrad M, Mangia F, Boitani C. The nuclear form of glutathione peroxidase 4 is associated with sperm nuclear matrix and is required for proper paternal chromatin decondensation at fertilization. J Cell Physiol 2012;227:1420–7. 10.1002/jcp.22857. 21618532.
20. Farina B, Di Sorbo G, Chambery A, Caporale A, Leoni G, Russo R, et al. Structural and biochemical insights of CypA and AIF interaction. Sci Rep 2017;7:1138. 10.1038/s41598-017-01337-8. 28442737.
21. Artus C, Boujrad H, Bouharrour A, Brunelle MN, Hoos S, Yuste VJ, et al. AIF promotes chromatinolysis and caspase-independent programmed necrosis by interacting with histone H2AX. EMBO J 2010;29:1585–99. 10.1038/emboj.2010.43. 20360685.
22. Gomez E, Buckingham DW, Brindle J, Lanzafame F, Irvine DS, Aitken RJ. Development of an image analysis system to monitor the retention of residual cytoplasm by human spermatozoa: correlation with biochemical markers of the cytoplasmic space, oxidative stress, and sperm function. J Androl 1996;17:276–87. 10.1002/j.1939-4640.1996.tb01783.x. 8792218.
23. Rengan AK, Agarwal A, van der Linde M, du Plessis SS. An investigation of excess residual cytoplasm in human spermatozoa and its distinction from the cytoplasmic droplet. Reprod Biol Endocrinol 2012;10:92. 10.1186/1477-7827-10-92. 23159014.
24. Kamiguchi Y, Tateno H. Radiation- and chemical-induced structural chromosome aberrations in human spermatozoa. Mutat Res 2002;504:183–91. 10.1016/s0027-5107(02)00091-x. 12106658.
25. Zhang T, Zhou X, Zhang X, Ren X, Wu J, Wang Z, et al. Gut microbiota may contribute to the postnatal male reproductive abnormalities induced by prenatal dibutyl phthalate exposure. Chemosphere 2022;287(Pt 1):132046. 10.1016/j.chemosphere.2021.132046. 34474386.
26. Fu H, Zhu X, Di Q, Sun J, Jiang Q, Xu Q. m6A contributes to a pro-survival state in GC-2 cells by facilitating DNA damage repair: novel perspectives on the mechanism underlying DEHP genotoxicity in male germ cells. Sci Total Environ 2023;859(Pt 2):160432. 10.1016/j.scitotenv.2022.160432. 36423848.
27. Teves ME, Roldan ER. Sperm bauplan and function and underlying processes of sperm formation and selection. Physiol Rev 2022;102:7–60. 10.1152/physrev.00009.2020. 33880962.
28. Johnsen SG. Testicular biopsy score count: a method for registration of spermatogenesis in human testes: normal values and results in 335 hypogonadal males. Hormones 1970;1:2–25. 10.1159/000178170. 5527187.
29. Evenson DP. The Sperm Chromatin Structure Assay (SCSA(®)) and other sperm DNA fragmentation tests for evaluation of sperm nuclear DNA integrity as related to fertility. Anim Reprod Sci 2016;169:56–75. 10.1016/j.anireprosci.2016.01.017. 26919909.
30. Young MD, Wakefield MJ, Smyth GK, Oshlack A. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol 2010;11:R14. 10.1186/gb-2010-11-2-r14. 20132535.
31. Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 2012;16:284–7. 10.1089/omi.2011.0118. 22455463.
32. Baritaud M, Boujrad H, Lorenzo HK, Krantic S, Susin SA. Histone H2AX: the missing link in AIF-mediated caspase-independent programmed necrosis. Cell Cycle 2010;9:3166–73. 10.4161/cc.9.16.12552. 20697199.
33. Groh KJ, Backhaus T, Carney-Almroth B, Geueke B, Inostroza PA, Lennquist A, et al. Overview of known plastic packaging-associated chemicals and their hazards. Sci Total Environ 2019;651(Pt 2):3253–68. 10.1016/j.scitotenv.2018.10.015. 30463173.
34. Gray TJ, Gangolli SD. Aspects of the testicular toxicity of phthalate esters. Environ Health Perspect 1986;65:229–35. 10.1289/ehp.8665229. 3709446.
35. Virant-Klun I, Imamovic-Kumalic S, Pinter B. From oxidative stress to male infertility: review of the associations of endocrine-disrupting chemicals (bisphenols, phthalates, and parabens) with human semen quality. Antioxidants (Basel) 2022;11:1617. 10.3390/antiox11081617. 36009337.
36. Gervasi MG, Visconti PE. Molecular changes and signaling events occurring in spermatozoa during epididymal maturation. Andrology 2017;5:204–18. 10.1111/andr.12320. 28297559.
37. Yoshida K, Muratani M, Araki H, Miura F, Suzuki T, Dohmae N, et al. Mapping of histone-binding sites in histone replacement-completed spermatozoa. Nat Commun 2018;9:3885. 10.1038/s41467-018-06243-9. 30250204.
38. Ogle RA, Netherton J, Schneider E, Velkov T, Zhang H, Cole N, et al. Nuclear heterogeneity is prevalent in high-quality fractionated human sperm cells typically used for assisted conception. Hum Reprod 2021;36:2073–82. 10.1093/humrep/deab134. 34097020.
39. Gangolli SD. Testicular effects of phthalate esters. Environ Health Perspect 1982;45:77–84. 10.1289/ehp.824577. 6754364.
40. Bahrami N, Goudarzi M, Hosseinzadeh A, Sabbagh S, Reiter RJ, Mehrzadi S. Evaluating the protective effects of melatonin on di(2-ethylhexyl) phthalate-induced testicular injury in adult mice. Biomed Pharmacother 2018;108:515–23. 10.1016/j.biopha.2018.09.044. 30243084.
41. Richburg JH, Boekelheide K. Mono-(2-ethylhexyl) phthalate rapidly alters both Sertoli cell vimentin filaments and germ cell apoptosis in young rat testes. Toxicol Appl Pharmacol 1996;137:42–50. 10.1006/taap.1996.0055. 8607140.
42. Evenson DP. Sperm Chromatin Structure Assay (SCSA®) for fertility assessment. Curr Protoc 2022;2e508. 10.1002/cpz1.508. 35926128.
43. Barroso G, Morshedi M, Oehninger S. Analysis of DNA fragmentation, plasma membrane translocation of phosphatidylserine and oxidative stress in human spermatozoa. Hum Reprod 2000;15:1338–44. 10.1093/humrep/15.6.1338. 10831565.
44. Aitken RJ, Findlay JK, Hutt KJ, Kerr JB. Apoptosis in the germ line. Reproduction 2011;141:139–50. 10.1530/rep-10-0232. 21148286.
45. Hao SL, Ni FD, Yang WX. The dynamics and regulation of chromatin remodeling during spermiogenesis. Gene 2019;706:201–10. 10.1016/j.gene.2019.05.027. 31085275.
46. Hecht NB. Molecular mechanisms of male germ cell differentiation. Bioessays 1998;20:555–61. 10.1002/(sici)1521-1878(199807)20:7<555::aid-bies6>3.0.co;2-j. 9723004.
47. Hess RA, Renato de Franca L. Spermatogenesis and cycle of the seminiferous epithelium. Adv Exp Med Biol 2008;636:1–15. 10.1007/978-0-387-09597-4_1. 19856159.
48. Ni K, Steger K, Yang H, Wang H, Hu K, Chen B. Sperm protamine mRNA ratio and DNA fragmentation index represent reliable clinical biomarkers for men with varicocele after microsurgical varicocele ligation. J Urol 2014;192:170–6. 10.1016/j.juro.2014.02.046. 24582535.
49. Iranpour FG, Nasr-Esfahani MH, Valojerdi MR, al-Taraihi TM. Chromomycin A3 staining as a useful tool for evaluation of male fertility. J Assist Reprod Genet 2000;17:60–6. 10.1023/a:1009406231811. 10754785.
50. Llavanera M, Ribas-Maynou J, Delgado-Bermudez A, Recuero S, Muino R, Hidalgo CO, et al. Sperm chromatin condensation as an in vivo fertility biomarker in bulls: a flow cytometry approach. J Anim Sci Biotechnol 2021;12:115. 10.1186/s40104-021-00634-7. 34749810.
51. Amor H, Shelko N, Hamad MF, Zeyad A, Hammadeh ME. An additional marker for sperm DNA quality evaluation in spermatozoa of male partners of couples undergoing assisted reproduction technique (IVF/ICSI): protamine ratio. Andrologia 2019;51e13400. 10.1111/and.13400. 31489691.
52. Lettieri G, D'Agostino G, Mele E, Cardito C, Esposito R, Cimmino A, et al. Discovery of the involvement in DNA oxidative damage of human sperm nuclear basic proteins of healthy young men living in polluted areas. Int J Mol Sci 2020;21:4198. 10.3390/ijms21124198. 32545547.
53. Arauz-Garofalo G, Jodar M, Vilanova M, de la Iglesia Rodriguez A, Castillo J, Soler-Ventura A, et al. Protamine characterization by top-down proteomics: boosting proteoform identification with DBSCAN. Proteomes 2021;9:21. 10.3390/proteomes9020021. 33946530.
54. van der Heijden GW, Derijck AA, Ramos L, Giele M, van der Vlag J, de Boer P. Transmission of modified nucleosomes from the mouse male germline to the zygote and subsequent remodeling of paternal chromatin. Dev Biol 2006;298:458–69. 10.1016/j.ydbio.2006.06.051. 16887113.
55. Zhang X, Zhang L, Zhu JH, Cheng WH. Nuclear selenoproteins and genome maintenance. IUBMB Life 2016;68:5–12. 10.1002/iub.1455. 26614639.
56. Wu Y, Wang J, Zhao T, Chen J, Kang L, Wei Y, et al. Di-(2-ethylhexyl) phthalate exposure leads to ferroptosis via the HIF-1α/HO-1 signaling pathway in mouse testes. J Hazard Mater 2022;426:127807. 10.1016/j.jhazmat.2021.127807. 34863575.
57. Ribas-Maynou J, Garcia-Bonavila E, Bonet S, Catalan J, Salas-Huetos A, Yeste M. The TUNEL assay underestimates the incidence of DNA damage in pig sperm due to chromatin condensation. Theriogenology 2021;174:94–101. 10.1016/j.theriogenology.2021.08.024. 34425305.
58. Miramar MD, Costantini P, Ravagnan L, Saraiva LM, Haouzi D, Brothers G, et al. NADH oxidase activity of mitochondrial apoptosis-inducing factor. J Biol Chem 2001;276:16391–8. 10.1074/jbc.m010498200. 11278689.
59. Litsios A, Grys BT, Kraus OZ, Friesen H, Ross C, Masinas MP, et al. Proteome-scale movements and compartment connectivity during the eukaryotic cell cycle. Cell 2024;187:1490–507.e21. 10.1016/j.cell.2024.02.014. 38452761.
60. Weis K. Importins and exportins: how to get in and out of the nucleus. Trends Biochem Sci 1998;23:185–9. 10.1016/s0968-0004(98)01204-3. 9612083.
61. Maiorino M, Mauri P, Roveri A, Benazzi L, Toppo S, Bosello V, et al. Primary structure of the nuclear forms of phospholipid hydroperoxide glutathione peroxidase (PHGPx) in rat spermatozoa. FEBS Lett 2005;579:667–70. 10.1016/j.febslet.2004.12.041. 15670826.

Article information Continued

Figure 1.

Results of nuclear glutathione peroxidase 4 (nGPx4) overexpression via lentiviral infection. (A) Quantification of immunofluorescence staining for nGPx4 protein expression, with the target protein shown in red, transfected viral cells in green, and nuclei counterstained with 4′,6-diamidino-2-phenylindole (DAPI) in blue. (B) Quantitative polymerase chain reaction results for nGPx4. (C) Western blot analysis of nGPx4 protein levels. Image analysis was performed using ImageJ, and the data are presented as mean±standard deviation. Scale bar: 20 µm. GC-1, germ cell line; NC, negative control; DMSO, dimethyl sulfoxide; MEHP, mono-2-ethylhexyl phthalate; GFP, green fluorescent protein. a)p<0.001; b)p<0.0001 compared with the control group.

Figure 2.

The effect of nuclear glutathione peroxidase 4 (nGPx4) overexpression on germ cell line (GC-1) spg cell proliferation and apoptosis after mono-2-ethylhexyl phthalate (MEHP) exposure. (A) cell counting kit-8 (CCK-8) assay results for the MEHP concentration gradient, showing significant differences between the nGPx4 and GC-1 groups (p<0.05) and highly significant differences between the GC-1/nGPx4 and negative control (NC) groups (p<0.0001) as well as between the nGPx4 and NC groups (p<0.0001). (B, C) CCK-8/5-ethynyl-2′-deoxyuridine (EdU) assay results demonstrating the influence of nGPx4 on cell proliferation at various time points following MEHP exposure, with highly significant differences between the GC-1+MEHP and NC+MEHP groups compared with the nGPx4+MEHP group (p<0.0001) and a significant difference between the GC-1+MEHP and nGPx4+MEHP groups (p<0.001). Images were analyzed using ImageJ, and data are presented as mean±standard deviation. Scale bar: 50 µm. ns, not significant; DMSO, dimethyl sulfoxide; DAPI, 4′,6-diamidino-2-phenylindole. a)Not significant differences between the GC-1/nGPx4; b)Not significant differences between the GC-1/NC groups; c),d)Highly significant differences between the GC-1/NC groups; e)Highly significant differences between the nGPx4/NC groups; f)p<0.001; g)p<0.0001 compared with the control group.

Figure 3.

Effects of nuclear glutathione peroxidase 4 (nGPx4) overexpression on DNA damage and apoptosis-related protein expression in germ cell line (GC-1) spg cells after mono-2-ethylhexyl phthalate (MEHP) exposure. Quantitative analysis of mRNA expression levels of (A) phosphorylated H2A histone variant (γ-H2A.X), (B) Caspase-3, (C) Bcl 2-associated X (Bax), and (D) B-cell lymphoma 2 (Bcl-2), demonstrating MEHP’s impact on these genes. (E) Western blot analysis of apoptosis-related proteins. (F) Quantitative immunofluorescence analysis of the DNA damage marker γ-H2A.X. Image analysis was performed using ImageJ, and the data are presented as mean±standard deviation. Scale bar: 20 µm. ns, not significant; NC, negative control; DMSO, dimethyl sulfoxide; DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 compared with the control group.

Figure 4.

Impact of nuclear glutathione peroxidase 4 (nGPx4) overexpression on truncated apoptosis-inducing factor (tAIF)/phosphorylated H2A histone variant (γ-H2A.X) axis activation and apoptosis in germ cell line (GC-1) spg cells following mono-2-ethylhexyl phthalate (MEHP) exposure. (A) Western blot analysis of AIF and γ-H2A.X protein expression. (B) Quantitative immunofluorescence analysis of the DNA damage marker AIF. (C) Expression of nGPx4. (D) Translocation of AIF from the cytoplasm to the nucleus. (E) Immunoprecipitation analysis from MEHP-treated and untreated groups using anti-γ-H2A.X/anti-immunoglobulin G (IgG) antibodies. (F) Quantitative mRNA expression analysis of nGPx4, AIF, and γ-H2A.X. (G, H) Flow cytometry analysis of apoptotic GC-1 cells following MEHP exposure. Data were analyzed using ImageJ and are expressed as mean±standard deviation. Scale bar: 20 µm. OE, overexpress; NC, negative control; IP, immunoprecipitation; IB, immunoblotting; DMSO, dimethyl sulfoxide; DAPI, 4′,6-diamidino-2-phenylindole; ns, not significant; 7-AAD, 7-aminoactinomycin D; APC, allophycocyanin-conjugated. a)p<0.01; b)p<0.001; c)p<0.0001 compared with the control group.

Figure 5.

RNA-seq analysis of mono-2-ethylhexyl phthalate (MEHP)-treated cells. (A) Heatmap of differentially expressed genes between the germ cell line (GC-1) group and the nuclear glutathione peroxidase 4 (nGPx4)/negative control (NC) group. (B) Differential gene expression between the NC and nGPx4 groups. (C, D) Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of differentially expressed genes. (E, F, G, H) Gene set enrichment analysis of related pathways. Data are expressed as mean±standard deviation. CENP-A, centromere protein A; PPAR, peroxisome proliferator-activated receptor.

Figure 6.

(A) Quantitative analysis of nuclear glutathione peroxidase 4 (nGPx4) mRNA. (B) Western blot analysis of nGPx4. (C) Mouse body weight. (D) Representative immunohistochemistry staining image for nGPx4. (E, F) Testis and epididymis coefficients. (G, H) Mouse sperm count and total motility rate. (I) Representative images of mouse sperm morphology. Green arrows indicate normal sperm morphology; red arrows denote head abnormalities; and orange and yellow arrows represent midpiece abnormalities. Data are presented as mean±standard deviation. Scale bar: 50 µm. WT, wild-type; DEHP, di(2-ethyl-hexyl) phthalate; NC, negative control; ns, not significant. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 compared with the control group.

Figure 7.

Hematoxylin and eosin (H&E) staining of mouse testicular seminiferous tubules (A) and epididymides (B). Blue arrows indicate spermatogonia (SG); red arrows, primary spermatocytes (PS); orange arrows, round spermatids (RS); and green arrows, elongated spermatids (ES). White short arrows denote vacuoles and cracks; black short arrows indicate thinning of seminiferous tubules; green short arrows mark abnormal sperm distribution; white long arrows denote sloughing germ cells; and black long arrows indicate vacuolation of the tubule lumen. Scale bars: 20 and 50 µm. WT, wild-type; DEHP, di(2-ethyl-hexyl) phthalate; nGPx4, nuclear glutathione peroxidase 4; NC, negative control.

Figure 8.

Flow cytometry analysis of acridine orange (AO) and chromomycin A3 (CMA3) data. (A) Western blot analysis of phosphorylated H2A histone variant (γ-H2A.X). (B, C) Immunofluorescence staining of γ-H2A.X in testis sections. (D) Quantitative mRNA expression analysis of γ-H2A.X. (E, F) AO orange fluorescence intensity. (G, H) CMA3 binding positivity rates. (I) Sperm chromatin status assessed by sperm chromatin structure analysis, showing DNA fragmentation index (DFI) and high DNA staining (HDS) percentages. Data are expressed as mean±standard deviation. Scale bar: 50 µm. ns, not significant; WT, wild-type; DEHP, di(2-ethyl-hexyl) phthalate; nGPx4, nuclear glutathione peroxidase 4; NC, negative control; DAPI, 4′,6-diamidino-2-phenylindole; PerCP-A, phycoerythrincy5.5; PE-A, phycoerythrin; FITC, fluorescein isothiocyanate. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 compared with the control group.

Figure 9.

Analysis of apoptosis in germ cells from the testes and epididymis following di(2-ethyl-hexyl) phthalate (DEHP) exposure. (A, B, C) Representative terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining images of testes and epididymides; TUNEL (red) and 4′,6-diamidino-2-phenylindole (DAPI; blue). (D, E, F) Quantitative analysis of mRNA expression levels for caspase-3, Bcl 2-associated X (Bax), and B-cell lymphoma 2 (Bcl-2). (G, H, I) Western blot analysis of caspase-3, Bax, and Bcl-2 in testes after DEHP exposure. Image analysis was performed using ImageJ, and data are expressed as mean±standard deviation. Scale bars: 200 and 50 µm. WT, wild-type; nGPx4, nuclear glutathione peroxidase 4; NC, negative control; ns, not significant. a)p<0.01; b)p<0.001; c)p<0.0001 compared with the control group.

Figure 10.

Di (2-ethyl-hexyl) phthalate (DEHP) exposure induces caspase-independent cell death in male mouse germ cells via the formation of the apoptosis-inducing factor (AIF)/phosphorylated H2A histone variant (γ-H2A.X) complex. After mice ingest DEHP, it is metabolized into mono-2-ethylhexyl phthalate (MEHP), which activates Bcl 2-associated X (Bax) to trigger the release of AIF from the mitochondria. The released truncated AIF (tAIF) translocates to the nucleus and forms a DNA degradation complex with γ-H2A.X/cyclophilin A (CypA), leading to DNA fragmentation. In severe cases, this process results in caspase-independent cell death. In contrast, nuclear glutathione peroxidase 4 (nGPx4) overexpression induces chromatin condensation and effectively downregulates γ-H2A.X expression, thereby mitigating caspase-independent cell death. Collectively, these mechanisms protect male mouse germ cells.

Table 1.

Antibodies used for Western blotting

Antibody Source Identifier Concentration
Lamin B1 antibody Thermo Fisher Cat.# 12987-1-AP 1:1,000
β-Actin antibody Proteintech Cat.# 20546-1-AP 1:5,000
GPx4 antibody Boster Cat.# BM5231 1:2,000
γ-H2AX antibody Abclonal Cat.# AP0687 1:1,000
Bcl-2 antibody Proteintech Cat.# 68103-1-IG 1:5,000
Bax antibody Proteintech Cat.# 60267-1-IG 1:5,000
AIF antibody Abclonal Cat.# A2568 1:1,000
Caspase-3 antibody Proteintech Cat.# 19677-1-AP 1:1,000
Goat anti-rabbit HRP-conjugated antibody Boster Cat.# BA1054 1:5,000
Goat anti-mouse HRP-conjugated antibody Abcam Cat.# ab205719 1:5,000

GPx4, glutathione peroxidase 4; γ-H2AX, phosphorylated H2A histone variant; Bcl-2, B-cell lymphoma 2; Bax, Bcl 2-associated X; AIF, apoptosis-inducing factor; HRP, horseradish peroxidase.

Table 2.

Primers used for quantitative polymerase chain reaction

Target gene Primer Primer sequence (5′–3′)
β-Actin Forward TGCTATGTTGCCCTAGACTTCG
Reverse GTTGGCATAGAGGTCTTTACGG
nGPx4 Forward AGTCCTAGGAAGCGCCCAG
Reverse CATCGCGGGATGCACACAAG
γ-H2A.X Forward CGGTGGGCTTGAAGGTTAGT
Reverse ACTGGTATGAGGCCAGCAAC
Bcl-2 Forward GAACTGGGGGAGGATTGTGG
Reverse GCATGCTGGGGCCATATAGT
Caspase-3 Forward CTAAACCTGGGTGAGCCGGTG
Reverse TCCAGATAGATCCCAGAGTCCAC
Bax Forward CTGGATCCAAGACCAGGGTG
Reverse CTTCCAGATGGTGAGCGAGG
AIF Forward TCCAGAGGCCGAAACAGAG
Reverse CAGCTCCTATTGTTGATAAGCCC

nGPx4, nuclear glutathione peroxidase 4; γ-H2A.X, phosphorylated H2A histone variant; Bcl-2, B-cell lymphoma 2; Bax, Bcl 2-associated X; AIF, apoptosis-inducing factor.