Osteocalcin improves testicular morphology but does not ameliorate testosterone synthesis signaling in azoospermic mice

Mahsa Yaghobinejad; Heidar Toolee; Somayeh Solhjoo; Elham Seifali; Soraya Parvari; Omotosho Dhulqarnain Akanji; Tayebeh Rastegar

doi:10.5653/cerm.2023.06674

Clin Exp Reprod Med > Volume 51(4); 2024 > Article

Yaghobinejad, Toolee, Solhjoo, Seifali, Parvari, Akanji, and Rastegar: Osteocalcin improves testicular morphology but does not ameliorate testosterone synthesis signaling in azoospermic mice

Original Article

Clinical and Experimental Reproductive Medicine 2024;51(4):344-352.

Published online: February 29, 2024

DOI: https://doi.org/10.5653/cerm.2023.06674

Osteocalcin improves testicular morphology but does not ameliorate testosterone synthesis signaling in azoospermic mice

Mahsa Yaghobinejad¹

, Heidar Toolee², Somayeh Solhjoo³, Elham Seifali⁴, Soraya Parvari⁵, Omotosho Dhulqarnain Akanji⁶, Tayebeh Rastegar¹

¹Anatomy Department, Medical School, Tehran University of Medical Science, Tehran, Iran

²School of Allied Medical Sciences, Shahrud University of Medical Sciences, Shahrud, Iran

³Anatomy Department, Medical School, Kerman University of Medical Science, Tehran, Iran

⁴Anatomy Department, Azad Islamic University of Medical Science, Tehran, Iran

⁵Anatomy Department, School of Medicine, Alborz University of Medical Science, Karaj, Iran

⁶Anatomy Department, Olabisi Onabanjo University, Sagamu, Nigeria

Corresponding author: Tayebeh Rastegar Anatomy Department, Medical School, Tehran University of Medical Science, Pouria st, Keshavarz Blvd., Tehran, Iran
Tel: +98-21-88953008 E-mail: trastegar@tums.ac.ir

^*This study was supported by a grant received from the Tehran University of Medical Sciences and Health Services, Tehran, Iran (grant number: 95‐04‐30‐30213).

Received November 5, 2023 Revised December 27, 2023 Accepted January 17, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objective

Osteocalcin (OCN) influences spermatogenesis in conjunction with testosterone and estrogen. OCN facilitates the secretion of testosterone by engaging with G protein-coupled receptor class C group 6 member A (GPRC6A) on Leydig cells and with androgen receptors on Sertoli cells.

Methods

Adult mice were assigned to the following groups: control; sham I, which received dimethyl sulfoxide for 5 weeks followed by phosphate-buffered saline for 1 month; azoospermia, which was treated with busulfan (40 mg/kg); sham II, which consisted of azoospermic animals that received phosphate-buffered saline for 1 month beginning at the 5-week mark; and the experimental group, which included azoospermic mice treated with OCN (3 ng/g/day) for 1 month.

Results

In the mice receiving OCN treatment, immunohistochemical analysis revealed increased expression of androgen receptors and GPRC6A, indicative of enhanced spermatogenesis. Additionally, the expression levels of the cyclic adenosine monophosphate-responsive element binding protein 1, steroidogenic acute regulatory protein, and cytochrome P450 family 11 genes were elevated. However, testosterone levels exhibited no significant differences across groups. Morphometric analysis suggests that OCN may play a crucial role in spermatogenesis, as evidenced by its positive effects on germinal cells and the germinal epithelium in the azoospermia group (p<0.05).

Conclusion

We conclude that OCN may serve as a beneficial therapeutic agent for male infertility.

Keywords: Bone matrix; Receptors, androgen; Signal transduction; Testosterone

Introduction

Infertility in men is attributed to azoospermia in 10% to 20% of cases, with 2% of the male population experiencing various forms of this condition [1]. Spermatogenesis is a complex process involving the proliferation and differentiation of spermatogonial stem cells, which ultimately mature into sperm [2]. This process involves four main cell types: Sertoli cells, Leydig cells, germ cells, and peritubular myoid cells. Additionally, the testis performs two primary functions: the production of steroid hormones (steroidogenesis) and the production of spermatozoa (spermatogenesis), both of which result from cooperation between these cells [3]. Sertoli cells, the first cells of the gonad to differentiate during human fetal development [4,5], not only represent a crucial structural component of the seminiferous epithelium but also provide physical protection and establish the blood-testis barrier. This barrier is essential for creating an optimal environment for stem cell development [3].

In conjunction with Leydig cells, Sertoli cells stimulate the production of steroid hormones [4,5] and possess receptors for testosterone known as androgen receptors (ARs). During the fertilization process, androgen hormones such as testosterone and estrogen are essential regulators [6]. Androgens and their receptors are important contributors to testicular function, which is crucial for the development of the male reproductive system and the regulation of spermatogenesis. AR activity is modulated by testosterone, a steroid ligand. The binding of this ligand initiates nuclear transduction and the transcriptional regulation of ARs [7]. Research on S-AR-Y models has demonstrated that ARs located in Sertoli cells are crucial for the differentiation of stem cells and for advancing the meiosis of primary spermatocytes. A reduction in the number of AR-positive Sertoli cells leads to a range of functional disorders and disrupts spermatogenesis before the completion of the second meiotic division [7-9].

Recently, the hormone osteocalcin (OCN) has been recognized as effective in promoting spermatogenesis. Although OCN is exclusively secreted by osteoblasts, it exerts only minor effects on bone mineralization and density. More notably, it has been found to participate in the endocrine regulation of several physiological processes, including glucose homeostasis, exercise capacity, brain development, cognition, and male fertility [10,11]. The undercarboxylated form of OCN has been shown to enhance reproduction in transgenic mouse models by increasing testosterone production and sperm count [12]. OCN directly influences testosterone production through G protein-coupled receptor class C group 6 member A (GPRC6A) on Leydig cells, which subsequently affects the testosterone receptor of Sertoli cells. The interaction of the undercarboxylated form of OCN with its receptors on Leydig cells leads to the production of cyclic adenosine monophosphate (cAMP). This, in turn, activates cAMP-responsive element binding protein 1 (CREB1), which triggers the expression of genes such as steroidogenic acute regulatory protein (StAR) and cytochrome P450 family 11 (CYP11). These are essential for testosterone biosynthesis [6]. The roles of OCN have been extensively investigated in areas such as beta cell proliferation, insulin insensitivity, and germ cell differentiation [13]. Research has suggested that OCN could be utilized to enhance the quality of spermatogenesis [14,15]. Consequently, we examined the impact of OCN on spermatogenesis, the expression levels of GPRC6A and ARs, and the associated signaling pathways in a busulfan-induced azoospermia mouse model.

Methods

1. Animals

Four to 6-week-old Naval Medical Research Institute male mice were maintained in accordance with the approved animal care guidelines of the Ethics Committee of Tehran University of Medical Sciences (Approval No. IR.TUMS.REC.1394.1838). The animals were housed under a 12:12 light:dark cycle, a humidity level of 50%±5%, and a temperature of 22±3 °C, with ad libitum access to food and water. Thirty male mice were used, with six animals in each group. In the control group, no intervention was applied. Mice in the azoospermia group received a single intraperitoneal dose of 40 mg/kg busulfan [16]. The sham I group consisted of mice that were administered dimethyl sulfoxide (the solvent used for busulfan), at 4 to 5 weeks of age; after 5 weeks, these mice received phosphate-buffered saline (PBS) for 1 month. The sham II group included azoospermic mice that were given PBS (the solvent typically used for OCN) for 1 month following 5 weeks of busulfan treatment. As depicted in Figure 1, the OCN group comprised azoospermic mice that received OCN (3 ng/g/day) (H00000632; Novus Biologicals) for 1 month [15].

2. Animal evaluation

At the conclusion of the treatment period (day 65), the mice were weighed and subjected to blood sampling before being euthanized. The collected blood samples were centrifuged at 2,600 rpm for 6 minutes for serum extraction. A lower transverse abdominal incision was made to expose the peritoneal cavity, allowing for the removal and weighing of the left testis in all groups. The testes were then preserved in a fixative for subsequent hematoxylin and eosin (H&E) staining and immunostaining experiments. Additionally, the right testis was stored at −80 °C for quantitative real-time polymerase chain reaction (qRT-PCR) analysis.

Busulfan (B2635; Sigma-Aldrich) was first dissolved in dimethyl sulfoxide (P8340; Sigma-Aldrich) to achieve a final concentration of 20 mg/mL. Subsequently, an equal volume of distilled water was added [17]. PBS was utilized as the solvent for OCN (P4417; Sigma-Aldrich) [14]. The azoospermia mouse model was established following the method described by Gholami et al. [16], with modifications. Mice received a single dose of busulfan (40 mg/kg) when they were between 4 to 6 weeks old. H&E staining of testicular tissue, as well as eosin-nigrosin staining of seminal fluid, were performed to evaluate the azoospermia model 5 weeks after injection (Figure 1) [18,19].

3. Assessment of azoospermia model

Testicular tissues from the designated groups were harvested and fixed in 10% paraformaldehyde (Sigma-Aldrich), then embedded in paraffin wax. Sections of 5-μm thickness were cut and stained with H&E. Subsequently, morphometric analyses of the seminiferous tubules were performed [20]. The eosin-nigrosin staining technique was used to evaluate the viability of sperm in a sample. A 50-μL droplet of semen was mixed with an equal volume of the stain. Then, 12 µL of this mixture was transferred with a pipette onto a slide and spread using a coverslip, creating a smear. The slides were left to incubate for approximately 30 seconds at room temperature to air-dry and were then examined immediately. At least 200 spermatozoa were evaluated under a high-resolution ×100 bright-field objective. Sperm that remained unstained were categorized as alive, while those that took on a blue color were identified as dead [19].

4. Morphometry of seminiferous tubules

In the process of counting spermatogonial cells, spermatocytes, round and elongated spermatids, Sertoli cells, myoid cells, and Leydig cells, the H&E-stained sections were examined using an optical microscope (CX31; Olympus). Images under ×40 magnification were captured with an Olympus E-30 camera and analyzed using ImageJ 1.46r (National Institutes of Health). Three fields of view from each slide were counted.

To measure the diameter of the seminiferous tubules, ×10 magnified images were analyzed. Two lines were drawn to represent the diameters of each tubule, and their average was calculated. The thickness of the germinal epithelium was determined by measuring the distance from the basement membrane to the lumen of the seminiferous tubules using ImageJ. These measurements were performed after calibration with a set scale.

5. Testosterone hormone assay

After anesthetizing the mice, blood samples were exsanguinated via cardiac puncture. Serum was separated by centrifugation at 2,600 rpm for 6 minutes in a refrigerated centrifuge and stored at −20 °C until analysis. Testosterone levels were measured using a kit (Item No. 582701; Cayman Chemical Company) following the protocol outlined in the manufacturer’s datasheet.

6. Immunohistochemistry of AR and GPRC6A

The expression levels of AR and GPRC6A in Sertoli and Leydig cells were assessed using immunohistochemistry (IHC). Tissues were fixed with 4% paraformaldehyde (Sigma‐Aldrich) and processed, after which 5-μm sections were prepared. The slides were permeabilized with 0.1% Triton X‐100 (Sigma‐Aldrich) and then blocked for 1 hour in 1% bovine serum albumin. Slides were incubated overnight with primary rabbit anti-AR antibody (SC-13062; Santa Cruz Biotechnology; at a dilution of 1:200) and anti-GPRC6A antibody (SC-67302; Santa Cruz Biotechnology; at a dilution of 1:200) separately. Subsequently, secondary goat anti-rabbit horseradish peroxidase-conjugated antibody (ab6721; Abcam; at a dilution of 1:100) was applied for 2 hours. Hematoxylin was used as a counterstain [21], and the slides were assessed using a bright-field microscope (LX71; Olympus).

7. qRT-PCR

qRT-PCR was employed to evaluate the expression levels of genes associated with the testosterone signaling pathway, including CREB1, StAR, and CYP11. Total RNA was extracted from the testes using RNX-Plus reagent (SinaClon). Subsequently, the RNA concentration was determined using a spectrophotometer (Eppendorf). Reverse transcription of 500 ng of the extracted RNA into complementary DNA (cDNA) was performed using a cDNA synthesis kit (PrimeScript RT Reagent Kit Fast, RR037A; Takara Bio Inc.). PCR amplification was conducted using a thermocycler (Bio-Rad Laboratories) and SYBR Green Master Mix (SYBR Premix Ex Taq II [Tli RNaseH Plus], RR820L; Takara Bio Inc.). The quality of the PCR reactions was assessed via melting curve analysis. Hypoxanthine guanine phosphoribosyltransferase (HPRT) was employed as a reference gene. The 2^−ΔΔCt method was used to calculate the relative expression levels of the selected genes. The primer sequences are provided in Table 1.

8. Statistical analysis

SPSS ver. 26 (IBM Corp.) was utilized for statistical analysis. Results are presented as mean±standard error. For normally distributed data, differences between mean values were evaluated using one-way analysis of variance, with adjustments made using the Tukey test. A p-value of less than 0.05 was considered to indicate statistical significance.

Results

1. Body and testis weight

Body weight showed no significant differences between groups (Table 2). However, the testis weight in the OCN group was significantly higher (p<0.05), while that in the azoospermia group was significantly lower than both the control and sham I groups (p<0.05).

2. Confirmation of azoospermia model

To confirm the azoospermia model, eosin-nigrosin and H&E staining were employed. Live sperm heads remained unstained when examined under a bright-field microscope using eosin-nigrosin staining (Figure 2B), whereas dead sperm absorbed the acidic dye (Figure 1Ba). The results of H&E staining of testicular tissue, observed through optical microscopy, indicated degeneration and vacuolation of the germinal epithelium in the azoospermia group compared to the control group, signifying the disruption of spermatogenesis (Figure 1Bc, 1Bd).

3. Assessment of seminiferous tubule parameters

The measurements of seminiferous tubule diameter in the azoospermia group (567.95±75.15 µm) and the sham II group (457.58±84 µm) were significantly lower (p<0.05) than that of the control group (690.25±77.7 µm). However, no significant differences were observed in the diameter of seminiferous tubules between the control, OCN (636.56±73.4 µm), and sham I (651.41±60.6 µm) groups (Figure 1C). The thickness of the germinal epithelium was also significantly lower (p<0.05) in both the azoospermia group (90.33±45.8 µm) and the sham II group (67.05±36.4 µm) relative to the control group. No significant differences were observed among the control, OCN (150.57±65.2 µm), and sham I (171.22±22.7 µm) groups (Figure 1Ch). As shown in Figure 1C, the total numbers of Leydig, Sertoli, and myoid cells did not exhibit any significant differences among the groups (Figure 1Ca-1Cc). However, the total numbers of spermatogonia, spermatocytes, elongated spermatids, and round spermatid cells counted in the OCN and sham I groups, compared to the azoospermia and sham II groups, displayed significant differences (p<0.05) (Figure 1Cd-1Cg).

4. Morphological studies

Histological assessment of the testes in male mice that received OCN demonstrated improvements in spermatogenesis and testicular morphology. However, no significant change was noted in the count of Leydig or Sertoli cells in the male mice with azoospermia. The control and sham I groups exhibited normal germinal epithelium morphology and spermatogenesis. In contrast, the azoospermia and sham II groups displayed vacuolated tubules (Figure 1Da-1Dd). A greater reduction in germ cells was associated with more extensive destruction of spermatogenesis. The seminiferous tubules in the OCN-treated group displayed a thick germinal epithelium, and the presence of various germ cells indicated the restoration of spermatogenesis (Figure 1De, 1Df).

5. Immunohistochemical analysis of AR and GPRC6A expression in Sertoli and Leydig cells

ARs are located on Sertoli cells, to which testosterone binds. Both the control and sham I groups exhibited normal Sertoli cells that expressed ARs (Figure 2B, 2C). Similarly, in the azoospermia and sham II groups, Sertoli cells were observed to express ARs (Figure 2D, 2E). The expression level of ARs in the OCN-treated group indicates an improvement in spermatogenesis (Figure 2A, 2F). However, no significant changes in the expression of ARs in Sertoli cells were observed in the images obtained from the IHC test across the studied groups (p<0.05).

6. Testosterone hormone assay

The testosterone level was measured using a kit from Cayman Chemical Company (No. 582701). No significant difference was found in serum testosterone levels among the study groups (p>0.05) (Figure 1Cj).

7. qRT-PCR results

The expression levels of selected genes related to the testosterone signaling pathway, including CREB1, StAR, and CYP11, were assessed using qRT-PCR. No significant differences in expression were observed between the control and sham I groups, or between the azoospermia and sham II groups. However, the expression levels of the CREB1, StAR, and CYP11 genes showed a dramatic increase in the OCN-treated group compared with the azoospermia and sham II groups (Figure 2).

Discussion

De Gendt et al. [8] have identified several factors contributing to decreased testicular weight, including the destruction of connective tissue, alterations in the morphology and function of Sertoli cells, degradation of the blood-testis barrier, and a reduction in the thickness of the germinal epithelium. These findings are consistent with our morphometric data, which show a decline in germinal thickness and diameter due to busulfan exposure, as well as impaired spermatogenesis. Furthermore, the observed beneficial effects of OCN on the germinal epithelium strongly support the key role of OCN in spermatogenesis and male fertility. In a previous study, Oury [22] reported that OCN-deficient mice (Ocn^−/−) exhibited reduced testis size, seminal vesicle weight, Leydig cell growth rate, and testosterone synthesis. However, we found no significant differences in the number of Leydig and Sertoli cells between the azoospermia mice and the animals treated with OCN. Notably, the type of azoospermia mouse model used may influence the results, and employing different models, such as inducing azoospermia through testicular torsion, could yield varying outcomes.

AR function is necessary for the suppressive effects of androgens on osteoblast activity, but it is not required for their impact on osteoclasts. AR is essential for male-specific bone formation and remodeling [23]. Both androgens and estrogens directly influence human bone cells through receptor-mediated mechanisms [24]. Androgens impact skeletal homeostasis throughout life, especially during puberty and adulthood, and testosterone is the primary gonadal sex steroid produced by the testes in men. Given that testosterone can be converted to estradiol by the aromatase enzyme, debate has continued regarding which gonadal sex steroid exerts a more substantial effect on the skeleton [25]. This study confirmed that OCN can improve the morphology of the germinal epithelium in the testis and support spermatogenesis. However, this treatment did not demonstrate an increase in the number of Leydig cells or in testosterone synthesis. Additionally, IHC analysis did not reveal significant differences between the various groups.

Numerous studies have recognized bone as an endocrine organ [8,12,15,22] due to its production of OCN and the subsequent binding of OCN to G protein-coupled receptors on Leydig cells (GPRC6A). This interaction leads to an increase in the number of Leydig cells, which in turn elevates testosterone secretion [4,12,22,26]. Additionally, emerging data suggest the existence of a novel bone-testis axis, wherein OCN regulates testosterone production in male, but not female, individuals. This axis may become more active during periods of skeletal growth, influenced by the endocrine hypothalamic-pituitary axis. During such growth phases, OCN may prompt the testes to produce testosterone, which could then impact bone size [27]. However, we did not observe significant differences in testosterone production through enzyme-linked immunosorbent assay analysis.

The primary endocrine regulatory pathway associated with male fertility is the hypothalamic-pituitary axis, in which luteinizing hormone promotes testosterone biosynthesis [15,28]. Our qPCR and morphometric findings demonstrated the activation of the hypothalamic-pituitary-testicular axis, which induces the activity of somatic cells, including Sertoli and Leydig cells. This was evidenced by significant increases in the expression of StAR, CREB1, and CYP11, which are key regulators of testosterone production. Collectively, various studies suggest that the regulation of testosterone production by OCN in Leydig cells cannot be solely attributed to the effects of OCN signaling through GPRC6A and AR in the hypothalamus or pituitary gland. By distinguishing between pituitary-dependent and bone-dependent mechanisms as regulators of male fertility, the experiments discussed above prompt further investigation into the role of OCN in reproductive function [15,29]. OCN has been shown to stimulate testosterone production in the testes, thus suggesting bone as an unexpected regulator of reproduction [30]. The identification of GPRC6A subsequently led to the recognition that CREB1 is a transcriptional effector of the role of OCN in regulating testosterone biosynthesis. This is achieved by enhancing the expression of key enzymes in the biosynthetic pathway within Leydig cells, such as StAR and CYP11 [31,32].

In conclusion, OCN plays a key role in spermatogenesis while supporting testicular morphology, and this hormone therefore may be considered a therapeutic agent for male infertility. However, further research is necessary to confirm the importance of OCN and its receptor on Leydig cells, as well as the AR on Sertoli cells, in human reproduction.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: MY, TR. Methodology: MY, HT, SS. Formal analysis: SS. Data curation: MY, HT, SS. Project administration: TR. Visualization: TR. Software: ES, SP. Validation: ODA, TR. Investigation: MY, ODA, TR. Writing-original draft: MY, TR. Writing-review & editing: ES, SP, ODA, TR. Approval of final manuscript: TR.

Acknowledgments

We would like to thank staff of Anatomical Department for their support.

Figure 1.

(A) Schematic illustration of the experiment. (B) (a) Eosin-nigrosin staining showing unstained (dead) sperm in the azoospermia group; (b) histological morphology of the testis 5 weeks after treatment with 40 mg/kg busulfan. Most sperm cells were destroyed, while interstitial tissue and Sertoli cells remained (scale bar: 50 µm). (C) Seminiferous tubule parameters. (a) Number of Leydig cells. (b) Number of Sertoli cells. (c) Number of myoid cells. (d) Number of spermatogonial cells. (e) Number of spematocytes. (f) Number of round spermatids. (g) Number of elongated spermatid cells. (h, i) Thickness of the germinal epithelium. (j) Testosterone hormone assay results. No significant changes were observed between the studied groups (p<0.05). (D) Hematoxylin and eosin staining. (a) Cross-section of testicular tissue from the control group. (b) Cross-section of testicular tissue from the sham II group, revealing the presence of vacuoles indicative of apoptosis. (c) Cross-section of testicular tissue from the sham I group. (d) Cross-section of testicular tissue from the azoospermia group; the absence of germinal cells is indicative of destroyed spermatogenic potential. (e) Cross-section of testicular tissue from the osteocalcin (OCN) group revealing the presence of various germinal cells, indicative of improved spermatogenesis. (f) Cross-section of testicular tissue from the OCN group (scale bar: 400 µm for a, b, c, d, and e; 1,000 µm for f). ^a)Significant compared to the control group; ^b)Significant compared to the sham I group; ^c)Significant compared to the azoospermia group; ^d)Significant compared to the sham II group.

Figure 2.

Immunohistochemistry staining. (A) Androgen receptor (AR)-positive Sertoli cells (arrowhead) displayed in the testicular interstitial tissue. (B) Cross-section of testicular tissue in the control group. (C) Cross-section of testicular tissue in the sham I group. (D) Cross-section of testicular tissue in the azoospermia group, displaying vacuolated tubules and a germinal epithelium indicative of destruction of spermatogenesis. (E) Cross-section of testicular tissue in the sham II group. (F) Cross-section of testicular tissue in the osteocalcin group, with a thick germinal layer and the presence of various germ cells indicating improved spermatogenesis (scale bar: 10 µm for A; 50 µm for B, C, D, E, and F). (G) Number of AR-positive Sertoli cells. (H) Testosterone synthesis signaling pathway transcripts in different groups (p<0.05). Star, steroidogenic acute regulatory protein; Cyp11, cytochrome P450 family 11; CREB, cyclic adenosine monophosphate-responsive element binding protein. ^a)Versus azoospermia group; ^b)Versus sham II group.

Table 1.

Primers and lengths of products: forward and reverse primer sequences

Amplicon	Forward sequences	Reverse sequences	Product length (bp)
HPRT	5′‐GCAGCGTTTCTGAGCCATTG‐3′	3′‐TCATCGCTAATCACGACGCT‐5′	172
CREB1	5′‐CCCTGGAGTTGTTATGGCGT‐3′	3′‐AGCACTGCCACTCTGTTCTC‐5′	165
StAR	5′‐CGGGTGGATGGGTCAAGTTC‐3′	3′‐GCACTTCGTCCCCGTTCTC‐5′	185
CYP11	5′‐GGATGCGTCGATACTCTTCTCA‐3′	3′‐GGACGATTCGGTCTTTCTTCCA‐5′	146

bp, base pair; HPRT, hypoxanthine guanine phosphoribosyltransferase; CREB1, cyclic adenosine monophosphate-responsive element binding protein 1; StAR, steroidogenic acute regulatory protein; CYP11, cytochrome P450 family 11.

Table 2.

Body and testis and weight

Group	Body weight (g)	Testis weight (g)
Control	45.14±0.9	0.16±0.03
Sham I	43.64±1.5	0.14±0.02^c),d)
Azoospermia	39.96±0.4	0.05±0.02^a),b)
Sham II	41±0.3	0.06±0.04
Osteocalcin	42.66±3.7	0.08±0.01^a),b)

Values are presented as mean±standard error. For all analyses, significance was indicated by p-values of less than 0.05.

^a)Significant difference from the control group; ^b)Significant difference from the sham I group; ^c)Significant difference from the azoospermia group; ^d)Significant difference from the sham II group.

References

1. Oates R. Evaluation of the azoospermic male. Asian J Androl 2012;14:82-7.

2. Geens M, Goossens E, De Block G, Ning L, Van Saen D, Tournaye H. Autologous spermatogonial stem cell transplantation in man: current obstacles for a future clinical application. Hum Reprod Update 2008;14:121-30.

3. Wang RS, Yeh S, Chen LM, Lin HY, Zhang C, Ni J, et al. Androgen receptor in sertoli cell is essential for germ cell nursery and junctional complex formation in mouse testes. Endocrinology 2006;147:5624-33.

4. Chang C, Chen YT, Yeh SD, Xu Q, Wang RS, Guillou F, et al. Infertility with defective spermatogenesis and hypotestosteronemia in male mice lacking the androgen receptor in Sertoli cells. Proc Natl Acad Sci U S A 2004;101:6876-81.

5. Xu Q, Lin HY, Yeh SD, Yu IC, Wang RS, Chen YT, et al. Infertility with defective spermatogenesis and steroidogenesis in male mice lacking androgen receptor in Leydig cells. Endocrine 2007;32:96-106.

6. Smith LB, Saunders PT. The skeleton: the new controller of male fertility? Cell 2011;144:642-3.

7. Holdcraft RW, Braun RE. Androgen receptor function is required in Sertoli cells for the terminal differentiation of haploid spermatids. Development 2004;131:459-67.

8. De Gendt K, Swinnen JV, Saunders PT, Schoonjans L, Dewerchin M, Devos A, et al. A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. Proc Natl Acad Sci U S A 2004;101:1327-32.

9. Allan CM, Rastegar T, Hazra R, He X, Desai R, Handelsman D. Sertoli cell-androgen receptor DNA-binding domain is essential for estradiol-induction of spermatogenesis. Biol Reprod 2012;87(Suppl 1): 442.

10. Moser SC, van der Eerden BC. Osteocalcin: a versatile bone-derived hormone. Front Endocrinol (Lausanne) 2019;9:794.

11. Karsenty G. Update on the biology of osteocalcin. Endocr Pract 2017;23:1270-4.

12. Schwetz V, Gumpold R, Graupp M, Hacker N, Schweighofer N, Trummer O, et al. Osteocalcin is not a strong determinant of serum testosterone and sperm count in men from infertile couples. Andrology 2013;1:590-4.

13. Shahrour HE, Al Fahom S, Al-Massarani G, AlSaadi AR, Magni P. Osteocalcin-expressing endothelial progenitor cells and serum osteocalcin forms are independent biomarkers of coronary atherosclerotic disease severity in male and female patients. J Endocrinol Invest 2022;45:1173-80.

14. Zhou B, Li H, Liu J, Xu L, Zang W, Wu S, et al. Intermittent injections of osteocalcin reverse autophagic dysfunction and endoplasmic reticulum stress resulting from diet-induced obesity in the vascular tissue via the NFκB-p65-dependent mechanism. Cell Cycle 2013;12:1901-13.

15. Oury F, Ferron M, Huizhen W, Confavreux C, Xu L, Lacombe J, et al. Osteocalcin regulates murine and human fertility through a pancreas-bone-testis axis. J Clin Invest 2013;123:2421-33.

16. Gholami M, Saki G, Hemadi M, Khodadadi A, Mohammadi-Asl J. Melatonin improves spermatogonial stem cells transplantation efficiency in azoospermic mice. Iran J Basic Med Sci 2014;17:93-9.

17. Ahar NH, Khaki A, Akbari G, Ghafarinovin M. The effect of busulfan on body weight, testis weight and MDA enzymes in male rats. Int J Womens Health Reprod Sci 2014;2:316-9.

18. Brinster CJ, Ryu BY, Avarbock MR, Karagenc L, Brinster RL, Orwig KE. Restoration of fertility by germ cell transplantation requires effective recipient preparation. Biol Reprod 2003;69:412-20.

19. Bjorndahl L, Soderlund I, Kvist U. Evaluation of the one-step eosin-nigrosin staining technique for human sperm vitality assessment. Hum Reprod 2003;18:813-6.

20. Bancroft JD, Layton C. The hematoxylins and eosin. In: Suvarna SK, Layton C, Bancroft JD, editors. Theory and practice of histological techniques. 7th ed. Elsevier; 2013. p. 173-86.

21. Rastegar T, Shafaat P, Mougahi SM, Parvari S, Solhjo S, Tooli H, et al. Osteocalcin improved spermatogenesis in azoospermic mouse model. Open Sci J 2018;3:1-12.

22. Oury F. A crosstalk between bone and gonads. Ann N Y Acad Sci 2012;1260:1-7.

23. Kawano H, Sato T, Yamada T, Matsumoto T, Sekine K, Watanabe T, et al. Suppressive function of androgen receptor in bone resorption. Proc Natl Acad Sci U S A 2003;100:9416-21.

24. Colvard DS, Eriksen EF, Keeting PE, Wilson EM, Lubahn DB, French FS, et al. Identification of androgen receptors in normal human osteoblast-like cells. Proc Natl Acad Sci U S A 1989;86:854-7.

25. Vanderschueren D, Vandenput L, Boonen S, Lindberg MK, Bouillon R, Ohlsson C. Androgens and bone. Endocr Rev 2004;25:389-425.

26. Khosla S, Riggs BL. Pathophysiology of age-related bone loss and osteoporosis. Endocrinol Metab Clin North Am 2005;34:1015-30.

27. Kirmani S, Atkinson EJ, Melton LJ 3rd, Riggs BL, Amin S, Khosla S. Relationship of testosterone and osteocalcin levels during growth. J Bone Miner Res 2011;26:2212-6.

28. Shan C, Yue J, Liu W. Broadening the role of osteocalcin in the hypothalamic-pituitary-gonadal axis. J Endocrinol 2021;249:R43-51.

29. Jawich K, Rocca MS, Al Fahoum S, Alhalabi M, Di Nisio A, Foresta C, et al. RS 2247911 polymorphism of GPRC6A gene and serum undercarboxylated-osteocalcin are associated with testis function. J Endocrinol Invest 2022;45:1673-82.

30. Cheng MH. Bones break the news on reproduction. Sci Transl Med 2011;3:73ec30.

31. Karsenty G, Oury F. Regulation of male fertility by the bone-derived hormone osteocalcin. Mol Cell Endocrinol 2014;382:521-6.

32. Matta RA, Farrage HM, Saedii AA, Abdelrahman MM. Male subclinical hypogonadism and late-onset hypergonadotrophic hypogonadism: mechanisms, endothelial function, and interplay between reproductive hormones, undercarboxylated osteocalcin, and endothelial dysfunction. Aging Male 2022;25:72-87.