Clin Exp Reprod Med Search

CLOSE


Clin Exp Reprod Med > Volume 52(3); 2025 > Article
Aqajanpor, Kondori, Asadi, Raei, Nezhadian, and Bahadoran: Photobiomodulation is more effective than long-term scrotal hyperthermia in improving testis tissue and spermatogenesis in mice with busulfan-induced azoospermia

Abstract

Objective

The use of photobiomodulation (PBM) for tissue repair has gained acceptance. This study investigated and compared the effects of PBM on mice exposed to scrotal hyperthermia and busulfan.

Methods

Forty 8-week-old adult mice were divided into five groups: (I) control, (II) hyperthermia, (III) busulfan, (IV) hyperthermia+PBM, and (V) busulfan+PBM. To induce azoospermia in groups II and IV, the scrotum of the mice was exposed to water at 43 °C every other day for 5 weeks. In groups III and V, a single dose of busulfan (45 mg/kg) was administered intraperitoneally. Mice in groups IV and V received laser irradiation (0.03 J/cm2/sec) every other day for 35 days.

Results

Molecular data analysis revealed that the levels of glutathione and the expression of proliferating cell nuclear antigen (Pcna) and stimulated by retinoic acid gene 8 (Stra8) genes were significantly higher in the busulfan+PBM group than in the hyperthermia+PBM group. Additionally, the number of testicular cells, tissue volume, and sperm parameters were also markedly higher in the busulfan+PBM group. Furthermore, this group exhibited a notable increase in serum testosterone levels.

Conclusion

The results demonstrated that laser therapy enhances testicular function and spermatogenesis by reducing the formation of reactive oxygen species and increasing the expression of mitotic genes following the induction of scrotal hyperthermia and busulfan injection. However, the effectiveness of PBM was greater in the busulfan+PBM group.

Introduction

In the reproductive system of male mammals, the testes play a central role in the complex, multi-stage process of spermatogenesis [1]. During this process, spermatogonial cells, also known as testis stem cells, differentiate into spermatocytes and spermatid germ cells through successive mitotic divisions [2]. Sperm production in the male gonads relies on the nutritional and structural support provided by Sertoli cells, hormone secretion from Leydig cells, and the integrity of the seminiferous tubules' epithelium [3]. Damage to the structure of the testes and alterations in their function, due to factors such as exposure to environmental stress and toxic drugs, are recognized as causes of male infertility [4].
Since stress can disrupt sperm production, germ cells grow and differentiate in a stress-free environment [5]. Environmental stressors such as heat shock can lead to the failure of sperm production [6,7]. In most mammals, the testis is located in the scrotum, which is typically 2 to 6 °C cooler than the core body temperature, protecting germ cells from the deleterious effects of heat. Any increase in scrotal temperature, whether chronic or transient, can make the male gonads susceptible to dysfunction [8]. Thermal shock causes stress to intracellular organelles, including the endoplasmic reticulum and mitochondria, and by increasing the formation of reactive oxygen species (ROS), it lays the groundwork for spermatogenesis failure [9]. Additionally, elevated levels of ROS are associated with the activation of apoptotic pathways, leading to cell death and testicular atrophy [10]. Furthermore, there is a clear link between the level of free radicals and damage to the genetic material of testicular cells, which is associated with disorders in gene expression [11].
Chemotherapy drugs, including busulfan (Bu), are known to disrupt spermatogenesis among other stressors. Bu, an alkylating anti-cancer agent, is commonly used in bone marrow transplantation for patients with chronic myeloid leukemia [12]. However, the adverse effects of Bu on the reproductive system are significant and include a reduction in testis weight, alterations in sperm parameters such as low count, poor morphology, reduced motility and viability, and can lead to temporary or permanent azoospermia [13]. In the testis tissue, spermatogonial stem cells are particularly vulnerable to the negative and toxic impacts of this drug, more so than other germ cells. At the molecular level, oxidative stress is a major contributor to the detrimental effects of Bu on the testis. This condition leads to the overproduction of free radicals, which activate the pathways involved in apoptosis, ultimately arresting spermatogenesis [14]. Considering that oxidative stress is a key factor in the negative effects of heat stress, mitigating the damage may be possible by balancing oxidants and antioxidants.
The use of low-level laser therapy or photobiomodulation (PBM) in tissues such as bone, skin, and muscle has yielded positive results [15]. Research indicates that near-infrared lasers enhance cell metabolism and tissue repair. Mitochondria, among the various cell organelles, receive the most exposure to laser irradiation. The energy released during PBM helps regulate mitochondrial membrane potential and the electron transport chain [16,17]. Previous studies have documented the beneficial effects of PBM on testicular function in both adulthood and pre-puberty. Additionally, there is evidence that laser irradiation modulates oxidative stress, which is linked to the stabilization of cellular DNA [18]. Furthermore, lasers play a significant role in improving both the quantity and quality of sperm parameters by minimizing damage to sperm mitochondria and facilitating the repair of the sperm membrane [19,20]. Despite these positive effects, the impact of lasers on histologic parameters has been less extensively explored.
The objective of this study was to investigate and compare the effects of laser irradiation on testicular function in two azoospermia models induced by scrotal hyperthermia (Hyp) and Bu. The molecular aspect of the research focused on assessing changes in ROS production and gene expression related to germ cell division. The histological aspect aimed to evaluate the organization and density of testicular cells within the seminiferous tubules.

Methods

In the present experiment, 40 adult male mice, each weighing 30 g and aged 8 weeks, were sourced from the Laboratory Animal Center at the Royan Institute in Tehran, Iran. These mice were accommodated in clean, transparent cages under a 12-hour light/12-hour dark cycle at a controlled temperature. They had unlimited access to food and water, in accordance with National Institutes of Health guidelines.

1. Study design

The mice were divided into five groups, each consisting of eight mice: (I) control (Cont), where the animals were not subjected to any intervention; (II) scrotal Hyp; (III) Bu; (IV) scrotal Hyp+PBM; and (V) Bu+PBM.

2. Induction of azoospermia

To induce azoospermia in groups II and III, the mice were anesthetized with ketamine (100 mg/kg) and xylazine (5 mg/kg). Subsequently, their scrotums were immersed in water at 43 °C for 20 minutes every other day over a period of 5 weeks. Following the Hyp treatment, the mice were dried and returned to their cages for recovery [21].
In groups III and V, the mice were administered a single intraperitoneal dose of Bu at 45 mg per kilogram of body weight and then observed for a period of 5 weeks [7].

3. Photobiomodulation

In the current study, we utilized a laser characterized by a wavelength of 890 nm, an energy density of 0.03 J/cm2/sec, a pulse frequency of 80 Hz, and a spot size of 1 cm2. After inducing azoospermia with scrotal Hyp and Bu, laser irradiation was applied to each testis of the mice in groups IV and V. The energy density used was 0.03 J/cm2/sec for 30 seconds, and this treatment was repeated every other day for 35 days [22]. After the completion of laser therapy, all mice in the study groups were anesthetized with ketamine (100 mg/kg). Subsequently, the epididymis was harvested to assess sperm parameters such as count, motility, viability, and sperm chromatin dispersion (SCD). The left and right testes were removed for molecular testing and stereological examination, respectively.

4. Sperm count, motility, and viability

After removal, the tail of the epididymis was placed into a Petri dish containing 1 mL of Ham's F10 culture medium (Sigma-Aldrich). It was then incubated at 37 °C for 20 minutes. Subsequently, to assess sperm motility, 10 µL of each sample was placed on a slide, and the progressive, motile, and immotile sperm were examined using a light microscope. Hemocytometer slides were utilized to determine the sperm count. Sperm viability was evaluated through eosin-nigrosine staining.

5. Sperm chromatin dispersion

The SCD test and the Halosperm kit (INDAS Laboratories) were used to assess sperm DNA fragmentation. Following the kit's staining instructions, the sperm samples were examined at ×100 magnification using a light microscope. Healthy sperm exhibited halos around their heads, while those lacking halos were identified as having DNA fragmentation [21].

6. Tissue preparation

The left testis of the mice was removed and immediately transferred to a –80 °C freezer for molecular testing. In contrast, the right testis was preserved in Bowen's fixative for 24 hours before being stored in 10% paraformaldehyde. Subsequently, the samples underwent processing in a tissue processor and were embedded in paraffin. Sections with a thickness of 5 µm were prepared from each sample for stereological analysis and stained with hematoxylin and eosin (H&E).

7. Number of testicular cells

To count the number of testicular cells, we employed the optical dissector method along with the formula provided [23]:
NV=Qh×P×a/f×tB.A
According to the equation, ΣQ represents the number of cells, h denotes the height of the dissector, t refers to the actual thickness of the section, Σp indicates the total counted fields, a/f represents the probe area divided by the magnification factor, and B.A is the thickness of the tissue section.

8. Voronoi tessellation

The distribution of cells within the tissue samples was analyzed using the Voronoi tessellation method. Texture images magnified by ×40 were analyzed using plugins in the ImageJ program (National Institutes of Health) to outline polygons. Initially, the cell nuclei were identified and labeled. Each individual cell determined the area occupied by its corresponding polygon. The software then measured the quantity and size of each polygon. The formula used to calculate the coefficient of variation (CV) as a comparative index of cell distribution is:
CV=standard deviation/mean×100
The index is interpreted as indicating a regular (CV <33%), random (33%< CV <64%), or clustered (CV >64%) cell distribution [24].

9. Testis volume

The total testicular volume was determined using Cavalieri’s method with the following formula [23]:
V=P×t×ap
In the aforementioned formula, ΣP indicates the total number of counted points, while a/p denotes the area of probe points divided by the magnification. The t represents the distance between different tissue sections.

10. Testosterone level

The mice were anesthetized with a 100 mg/kg dose of ketamine. Subsequently, 1 mL of blood was drawn from the heart. The blood samples were then centrifuged at 5,500 rpm for 5 minutes, and the collected serum was stored at –80 °C. Serum testosterone levels were measured using a specific enzyme-linked immunosorbent assay kit (catalog no: MBS494055).

11. Testicular ROS and glutathione content

The formation of ROS in the testis was determined using a spectrofluorimetric method and dichlorofluorescin diacetate (DCFDA) (Sigma-Aldrich). For the assay, 50 mg of each sample was mixed with 100 µL of DCFDA. The samples were then incubated at 37 °C for 45 minutes. After incubation, the lysed samples were centrifuged at 1,500 rpm for 5 minutes. Finally, the supernatant was analyzed with a spectrofluorometer at a wavelength of 488 nm. The glutathione (GSH) content was measured using a GSH assay kit (Zellbio). According to the manufacturer's instructions, 100 mg of the sample was homogenized in 0.4 mL of GSH buffer. Subsequently, 100 µL of 5-sulfosalicylic acid was added, and the mixture was centrifuged at 8,000 ×g for 10 minutes. The supernatant was then collected and transferred to a fresh tube. To measure the total GSH content, 160 µL of the reaction mix was added to the well and allowed to stand at room temperature for 10 minutes. Next, 20 µL of the sample was added to the well and incubated at 22±3 °C for 10 minutes. In the final step, 20 µL of substrate solution was added to the well and incubated at the same temperature. The absorbance was read at 415 nm using a microplate reader [25].

12. Analysis of Pcna, C-kit, and Stra8 by real-time polymerase chain reaction

The left testis was immediately transferred to –80 °C after removal from the body of mice. To eliminate genomic contamination, the extracted RNA underwent treatment with DNaseI (Roche). Following the kit's instructions, cDNA synthesis was conducted at 42 °C for 60 minutes (Fermentas). The relative expression levels of the proliferating cell nuclear antigen (Pcna), C-kit, and stimulated by retinoic acid gene 8 (Stra8) genes were quantified using real-time polymerase chain reaction (PCR). The cycle threshold (CT) numbers for both reference and major genes in each sample were calculated using the 2−ΔΔCT formula, which indicates the relative expression changes of each gene. Primer pairs were designed using Primer 3 Plus software. PCR primers designed by Primer 3 Plus were evaluated using the Primer Blast tool before the experiment was conducted. Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was used as the housekeeping gene (Table 1).

13. Statistical analysis

The Shapiro-Wilk test was utilized to assess the normality of the data, while one-way analysis of variance and Tukey's post hoc test were conducted using SPSS ver. 21 software (IBM Co.) for analysis. The values were presented as mean±standard deviation, with significance determined at p<0.05.

14. Ethical considerations

The Research Ethics Committees for Laboratory Animals at Baqiyatallah University of Medical Sciences in Tehran, Iran, approved all the protocols (Code: IR.BMSU.AEC. 1402.027). Animal samples were used in this study. The ethics certificate is attached.

Results

1. Sperm parameters

Our data analysis revealed a significant reduction in sperm count in both the Hyp and Bu groups when compared to the Cont group (p<0.0001 for both comparisons). Remarkably, sperm counts in the Hyp+PBM and Bu+PBM groups showed significant recovery compared to the Hyp and Bu groups (p<0.01 and p<0.001, respectively). Additionally, the overall sperm count in the Bu+PBM group was significantly higher than that in the Hyp+PBM group (p<0.05) (Figure 1A).
The percentage of motile sperm in both the Hyp and Bu groups was significantly lower than in the Cont group (p<0.0001 for both). Sperm motility significantly improved in the Bu+PBM group compared to the Bu group (p<0.01). Additionally, this parameter was significantly higher in the Bu+PBM group than in the Hyp+PBM group (p<0.01) (Figure 1B).
The viability of sperm in the Hyp and Bu groups was significantly lower than in the Cont group (p<0.0001 for both). Laser irradiation improved sperm viability in mice with azoospermia induced by Bu (p<0.05). No notable differences were observed between the two groups exposed to PBM (Figure 1C, 1D).

2. Sperm chromatin dispersion

The mice exposed to Hyp and Bu exhibited a significant increase in the percentage of sperm with fragmented DNA compared to the Cont group (p<0.0001 and p<0.001, respectively). Data analysis revealed no significant differences between the damaged and treatment groups. However, the DNA fragmentation index was significantly lower in the Bu+PBM group than in the Hyp+PBM group (p<0.05) (Figure 2).

3. Total number of testicular cells

Our data indicated that exposure to Hyp and Bu reduced the quantity of germ cells and somatic cells in the testis tissue of mice. Based on the analysis, there was a significant reduction in the number of spermatogonia in the Hyp and Bu groups compared to the Cont group (p<0.0001 for both). Laser therapy increased the number of these stem cells compared to the Hyp and Bu groups (p<0.01 for both). No notable differences were observed between the two groups exposed to PBM (Figure 3).
The number of spermatocytes was significantly reduced in mice treated with Hyp and Bu compared to intact mice (p<0.0001 for both). PBM notably increased the number of spermatocytes compared to the Hyp and Bu groups (p<0.05 and p<0.0001, respectively). Additionally, there was a significant difference between the two treated groups (p<0.05) (Figure 3B-3F).
Our observations revealed a significant reduction in the number of spermatids in both the Hyp and Bu groups compared to the Cont group (p<0.0001 for both). Following laser therapy, there was a notable increase in the number of these cells compared to the Bu group (p<0.001). The increase in the number of this germ cell was more significant in the Bu+PBM group than in the Hyp+PBM group (p<0.05) (Figure 3C-3F).
Counting the number of Sertoli cells revealed a significant decrease following Hyp and Bu treatment compared to the intact group (p<0.0001 for both). Laser irradiation significantly increased the quantity of these supporting cells compared to the Hyp and Bu groups (p<0.05 for both). Additionally, there was a significant difference in the number of Sertoli cells between the two treated groups (p<0.05) (Figure 3D-3F).
The number of Leydig cells was significantly lower in both the Hyp and Bu groups than in the Cont group (p<0.0001 for both). PBM significantly increased the number of Leydig cells compared to the Bu group (p<0.001). Additionally, laser therapy was more effective in increasing the number of Leydig cells in Bu-induced mice than in Hyp-induced mice (p<0.05) (Figure 3E, 3F).

4. Voronoi tessellation

The mean area of polygons in the Hyp and Bu groups was significantly larger compared to the Cont groups (p<0.0001 for both). Following PBM, the area of the polygons experienced a notable decrease. The reduction in the area was greater in the Bu+PBM group than in the Hyp+PBM group (p<0.001) (Figures 4 and 5A).
The CV analysis revealed that the Cont and Bu+PBM groups exhibited a regular distribution of cells, with a CV of less than 33%. In contrast, the other groups showed a random distribution, with CV values ranging from 33% to 64% (Figures 4 and 5B).
According to the analysis, 93% of the polygons in the Cont group have an area smaller than 80 µm2. In the Hyp group, this percentage drops to 35%, and in the Bu group, it is 42%. The number of polygons with an area less than 80 µm2 increased following laser treatment. The difference in findings was more pronounced in the Bu+PBM group compared to the Hyp+PBM group (p<0.05) (Figures 4 and 5C).

5. Testicular volume

The volume of testicular tissue significantly decreased after inducing Hyp and administering Bu, compared to that in intact mice (p<0.0001 for both treatments). PBM significantly enhanced testicular volume in mice with azoospermia induced by Bu (p<0.001). Additionally, the increase in testicular volume in the Bu+PBM group was significantly greater than that in the Hyp+PBM group (p<0.05) (Figure 6A).

6. Testosterone level

Based on the data from the hormonal assay kit, serum testosterone levels in both the Hyp and Bu groups were significantly lower than in the Cont group (p<0.0001 for both). Laser therapy significantly increased testosterone levels in Bu-injected mice (p<0.01). Additionally, the serum testosterone levels in the Bu+PBM group were noticeably higher than those in the Hyp+PBM group (p<0.05) (Figure 6B).

7. ROS production and GSH content

Total ROS generation in the testis tissue of mice induced with Hyp and Bu was significantly higher than in the Cont group (p<0.0001 for both). PBM notably decreased ROS production compared to the Hyp and Bu groups (p<0.0001 for both). There was no significant difference in ROS levels between the two treated groups (Figure 7A).
The GSH content in the testes of mice in both the Hyp and Bu groups was significantly lower compared to the Cont group (p<0.0001 for both comparisons). Laser irradiation significantly increased GSH content when compared to the Hyp and Bu groups (p<0.0001 for both comparisons). Our observations also revealed a significant difference between the two treated groups (p<0.05) (Figure 7B).

8. Expression of Pcna, C-kit, and Stra8

The relative expression of Pcna was significantly lower in both the Hyp and Bu groups than in the Cont group (p<0.0001 for both). PBM markedly increased the expression of this gene compared to the Bu group (p<0.001). There was a significant difference in the expression levels between the two groups treated with laser irradiation (p<0.05) (Figure 8A).
Based on the analysis, expression of C-kit was notably reduced in mice induced with Hyp and Bu compared to the intact mice (p<0.0001 for both). Laser therapy significantly increased the expression of this gene compared to the Hyp and Bu groups (p<0.01 and p<0.001, respectively). There was no significant difference between the two treated groups (Figure 8B).
The mRNA expression of stra8 showed a significant decrease in the Hyp and Bu compared to the intact mice (p<0.0001 for both). Laser therapy significantly increased the expression of this gene compared to the Bu group (p<0.001). Additionally, there was a notable difference between the Bu+PBM group and the Hyp+PBM group (p<0.01) (Figure 8C).

Discussion

In the present study, we investigated and compared the effects of PBM on spermatogenesis and testis tissue following the induction of scrotal Hyp and Bu in mice. The findings indicated that PBM significantly improved both histological and molecular parameters in the injured mice, with more pronounced improvements observed in the Bu+PBM group. Following testicular damage, the disruption of hemostasis causes the cells to produce free radicals [26]. Sertoli cells, located within the seminiferous tubules, contain a high number of mitochondria. Damage to these mitochondria increases the level of ROS. PBM helps reduce ROS formation by regulating mitochondrial respiratory chain function [20,27]. The study also noted an increase in the number of Sertoli cells, particularly in the Bu+PBM group compared to the Hyp+PBM group. This difference is likely due to the combined effects of Bu and Hyp, as Bu specifically targets the germ cells in the testis. Additionally, there was an increase in GSH content in the laser-treated mice. The rise in antioxidants within the testis mitigates the damage caused by oxidative stress and promotes spermatogenesis. Since Sertoli cells are the primary source of GSH production in the testis [26,28], there is a direct correlation between the number of Sertoli cells and the level of GSH.
Real-time PCR test data indicated that the expression of Pcna, C-kit, and Stra8 genes was downregulated at the mRNA level in damaged mice. Hyp and Bu contribute to this reduction in gene expression, which in turn decreases the mitotic division of spermatogonial stem cells and the meiosis of other germ cells [21,29]. Conversely, gene expression increased in mice treated with PBM. Laser photons can mitigate the damage caused by ROS to the genetic material of spermatogenic cells and create a conducive environment for their division. Additionally, PBM enhances the integrity of cellular DNA, ultimately promoting cell proliferation [30]. Furthermore, an increase in the number of Sertoli cells, which play a crucial role in the nourishment of stem cells, is another factor contributing to improved gene expression [31]. Improving gene expression positively impacts the final cell count. Thus, it can be inferred that there is a direct correlation between gene expression, stereological findings, and the spatial distribution of cells. The Pcna and Stra8 genes are essential for inducing the mitosis of spermatogonial cells and the meiosis of germ cells, respectively [32,33]. The mean number of germ cells in the laser-treated groups exceeded that in the damaged groups. Therefore, the observed increase in cell count in this study appears to be dependent on gene expression. In this context, the increase in testis volume can be attributed to a higher cell count.
Another finding was an increase in testosterone levels in mice treated with lasers. The enhancement of this hormone's serum level is linked to the function of Leydig cells. It has been noted that both Bu and scrotal Hyp reduce the population of these cells and decrease testosterone production. Conversely, PBM significantly increased the number of Leydig cells, which corresponded with an improvement in serum testosterone levels. Recent evidence suggests that PBM boosts testosterone production by stimulating 17β-hydroxysteroid dehydrogenase [34]. This hormone positively influences the expression of mitotic and meiotic genes in germ cells, which is one of the reasons for the increased population of these cells [35]. Thus, a close relationship exists between testosterone levels and the number of germ cells.
Our observations indicated that sperm parameters in treated mice significantly surpassed those in damaged mice. Stereological findings revealed an improvement in the number of spermatids following laser irradiation, suggesting a related increase in sperm count. Mitochondria serve as the energy source for sperm movement. Environmental stressors, including Hyp and chemotherapy drugs, disrupt mitochondrial function, leading to sperm immobility [7,14,36].
Following PBM, there was a significant improvement in the percentage of motile sperm. PBM enhances mitochondrial activity through several mechanisms, including the absorption of photons by cytochrome c oxidase, an increase in mitochondrial membrane potential, and the activation of calcium pumps [37,38]. Therefore, PBM plays a pivotal role in regulating mitochondrial function, which is crucial for sperm motility. Previous studies have shown that the sperm plasma membrane can be damaged by heat stress and Bu exposure, leading to a decrease in the percentage of viable sperm. However, PBM has been shown to increase sperm viability. Rezaei et al. [39] reported that sperm viability significantly improved following 0.03 J/cm2/sec laser irradiation in mice treated with Bu. The improvement in ion flow and stabilization of the sperm plasma membrane by PBM contributes to this increase in viability. Our findings are consistent with these observations.
In the analysis of sperm parameters, a significant increase in the percentage of DNA fragmentation index was noted in both damaged groups. Heat stress and Bu are crucial in causing DNA fragmentation in epididymal sperm by inducing DNA instability and oxidative stress [40]. A notable decrease in the number of sperm cells with positive DNA fragmentation was observed in the Bu+PBM group. Previous evidence supports the notion that laser therapy offers cellular protection against genetic damage, which is linked to the normal maturation of cellular DNA [41]. Further findings indicate that PBM helps protect and stabilize spermatozoa DNA by reducing ROS levels. Laser irradiation proved to be more effective in recovering Bu-induced damage in mice compared to damage induced by scrotal Hyp. Long-term Hyp appears to exert severe toxic effects on the epididymis, delaying the reversal of spermatogenesis more significantly than Bu [42]. For this reason, better recovery was observed in Bu-treated mice following laser irradiation.
Oxidative stress has been identified as the primary mechanism of damage to testicular tissue and spermatogenesis in mice subjected to scrotal Hyp and Bu treatment. Laser irradiation mitigates this damage by decreasing the formation of ROS and increasing GSH levels, thereby increasing the expression of the Pcna, C-kit, and Stra8 genes in the testis. This leads to an increase in the average number of germ and somatic cells, and ultimately, improves sperm parameters. Furthermore, laser treatment has shown greater efficacy in enhancing spermatogenesis in the Bu model compared to scrotal Hyp. Consequently, PMB is recommended to support sperm production following chemotherapy drug administration. Nonetheless, further research is required.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: FA, HB. Methodology: MHA, MGN, BJK. Formal analysis: MR, MGN. Data curation: MHA, MR, HB. Project administration: BJK, HB. Visualization: FA, MHA, MGN. Writing-original draft: FA, BJK, HB. Writing-review & editing: MHA, MR, MGN. Approval of final manuscript: FA, BJK, HB.

Figure 1.
The mean±standard deviation of sperm parameters improved following laser treatment. The busulfan (Bu)+photobiomodulation (PBM) group experienced greater improvements in sperm count and motility compared to the hyperthermia (Hyp)+PBM group. (A) Count, (B) motility, (C) viability, and (D) photomicrograph of sperm stained with eosin-nigrosin at ×100 magnification. The white arrowhead indicates healthy sperm, while the black arrowhead points to non-viable sperm. Cont, control. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=5).
cerm-2024-07430f1.jpg
Figure 2.
(A) The mean±standard deviation of sperm DNA fragmentation decreased following laser treatment. The busulfan (Bu)+photobiomodulation (PBM) group exhibited fewer sperm with halos around their heads than the hyperthermia (Hyp)+PBM group. (B) Photomicrograph of sperm stained using an sperm chromatin dispersion (SCD) kit at ×100 magnification. Black arrows point to non-fragmented DNA, whereas arrowheads indicate fragmented DNA. Cont, control. a)p<0.05; b)p<0.001; c)p<0.0001 (n=5).
cerm-2024-07430f2.jpg
Figure 3.
The mean±standard deviation of both germ cells and somatic cells in the testes increased in mice subjected to laser treatment. The busulfan (Bu)+photobiomodulation (PBM) group exhibited a higher count of spermatocytes, spermatids, Leydig cells (LCs), and Sertoli cells (SCs) than the hyperthermia (Hyp)+PBM group. The figure labels include: (A) spermatogonia (SG), (B) spermatocyte, (C) spermatid, (D) LC, (E) SC, and (F) marked cells in testis tissue stained with hematoxylin and eosin at ×40 magnification. Cont, control; RS, round spermatid; PS, primary spermatocyte. Statistical significance is indicated as follows: a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=6).
cerm-2024-07430f3.jpg
Figure 4.
Micrograph of seminiferous tubules and schematic of Voronoi tessellation in the spermatogenic epithelium. (A, B) Control, (C, D) hyperthermia, (E, F) busulfan, (G, H) hyperthermia+photobiomodulation, and (I, J) busulfan+photobiomodulation.
cerm-2024-07430f4.jpg
Figure 5.
Analysis of the spatial pattern of testicular cells using Voronoi tessellation. (A) Following photobiomodulation (PBM), the mean size of the Voronoi polygons significantly decreased. (B) The coefficient of variation (CV) in the laser-treated groups indicates a regular arrangement of cells. (C) The distribution of Voronoi polygon areas shows a difference between groups. Cont, control; Hyp, hyperthermia; Bu, busulfan. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=6).
cerm-2024-07430f5.jpg
Figure 6.
(A) The mean±standard deviation of testicular volume showed improvement following laser treatment. The busulfan (Bu)+photobiomodulation (PBM) group exhibited a more significant increase in volume than the other treated group. (B) The mean±standard deviation of serum testosterone levels increased after laser therapy. The rise in the Bu+PBM group was greater than that in the hyperthermia (Hyp)+PBM group. Cont, control. a)p<0.05, b)p<0.01, c)p<0.001, d)p<0.0001 (n=6); e)p<0.05, f)p<0.01, g)p<0.0001 (n=5).
cerm-2024-07430f6.jpg
Figure 7.
The mean±standard deviation of reactive oxygen species (ROS) formation decreased, while glutathione (GSH) content increased following laser irradiation. These changes were more pronounced in the busulfan (Bu)+photobiomodulation (PBM) group than in the hyperthermia (Hyp)+PBM group. (A) ROS and (B) GSH. Cont, control. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=5).
cerm-2024-07430f7.jpg
Figure 8.
The mean±standard deviation of the expression of mitotic and miotic genes increased following laser irradiation. The busulfan (Bu)+photobiomodulation (PBM) group exhibited higher expression levels of stimulated by retinoic acid gene 8 (Stra8) and proliferating cell nuclear antigen (Pcna) than the hyperthermia (Hyp)+PBM group. (A) Pcna, (B) C-kit, and (C) Stra8. Cont, control. a)p<0.05; b)p<0.01; c)p<0.001; d)p<0.0001 (n=5).
cerm-2024-07430f8.jpg
Table 1.
Primer design
Genes Primers sequences Product size (bp)
Pcna F: GATGTGGAGCAACTTGGAAT 160
R: AGCTCTCCACTTGCAGAAA
C-kit F: GCATCACCATCAAAAACGTG 332
R: GATAGTCAGCGTCTCCTGGC
Stra8 F: TGTAGAGAGAGAGGTAGAGGAGT 151
R: ATGTGGAGAGATGATGCTGTT
Gapdh F: CAGAACATCATCCCAGCCTCC 293
R: TTGGCAGGTTTCTCAAGACGG

Pcna, proliferating cell nuclear antigen; Stra8, stimulated by retinoic acid gene 8; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.

References

1. Nakano T, Nakata H, Kadomoto S, Iwamoto H, Yaegashi H, Iijima M, et al. Three-dimensional morphological analysis of spermatogenesis in aged mouse testes. Sci Rep 2021;11:23007.
crossref pmid pmc pdf
2. Diao L, Turek PJ, John CM, Fang F, Reijo Pera RA. Roles of spermatogonial stem cells in spermatogenesis and fertility restoration. Front Endocrinol (Lausanne) 2022;13:895528.
crossref pmid pmc
3. Ge RS, Li X, Wang Y. Leydig cell and spermatogenesis. Adv Exp Med Biol 2021;1288:111-29.
crossref pmid
4. Eisenberg ML, Esteves SC, Lamb DJ, Hotaling JM, Giwercman A, Hwang K, et al. Male infertility. Nat Rev Dis Primers 2023;9:49.
crossref pmid pdf
5. Maiorino M, Ursini F. Oxidative stress, spermatogenesis and fertility. Biol Chem 2002;383:591-7.
crossref pmid
6. Gao Y, Wang C, Wang K, He C, Hu K, Liang M. The effects and molecular mechanism of heat stress on spermatogenesis and the mitigation measures. Syst Biol Reprod Med 2022;68:331-47.
crossref pmid
7. Mafi Balani M, Ghafari Novin M, Sabbagh Alvani M, Raee P, Afshar A, Aghajanpour F, et al. An elderberry-supplemented diet improves spermatogenesis in mice with busulfan-induced azoospermia. Reprod Fertil Dev 2022;34:1078-88.
crossref pmid
8. Abdelhamid MH, Walschaerts M, Ahmad G, Mieusset R, Bujan L, Hamdi S. Mild experimental increase in testis and epididymis temperature in men: effects on sperm morphology according to spermatogenesis stages. Transl Androl Urol 2019;8:651-65.
crossref pmid pmc
9. Manoli I, Alesci S, Blackman MR, Su YA, Rennert OM, Chrousos GP. Mitochondria as key components of the stress response. Trends Endocrinol Metab 2007;18:190-8.
crossref pmid
10. Houston BJ, Nixon B, Martin JH, De Iuliis GN, Trigg NA, Bromfield EG, et al. Heat exposure induces oxidative stress and DNA damage in the male germ line. Biol Reprod 2018;98:593-606.
crossref pmid
11. Dizdaroglu M, Jaruga P. Mechanisms of free radical-induced damage to DNA. Free Radic Res 2012;46:382-419.
crossref pmid
12. Montecino-Rodriguez E, Dorshkind K. Use of busulfan to condition mice for bone marrow transplantation. STAR Protoc 2020;1:100159.
crossref pmid pmc
13. Nakata H, Nakano T, Iseki S, Mizokami A. Three-dimensional analysis of busulfan-induced spermatogenesis disorder in mice. Front Cell Dev Biol 2020;8:609278.
crossref pmid pmc
14. Ghaffari Novin M, Sabbagh Alvani M, Mafi Balani M, Aliaghaei A, Afshar A, Aghajanpour F, et al. Therapeutic effects of edaravone on azoospermia: free radical scavenging and autophagy modulation in testicular tissue of mice. J Reprod Infertil 2022;23:73-83.
crossref pmid pmc
15. Ventura RD. An overview of laser-assisted bioprinting (LAB) in tissue engineering applications. Med Lasers 2021;10:76-81.
crossref
16. Amaroli A, Pasquale C, Zekiy A, Utyuzh A, Benedicenti S, Signore A, et al. Photobiomodulation and oxidative stress: 980 nm diode laser light regulates mitochondrial activity and reactive oxygen species production. Oxid Med Cell Longev 2021;2021:6626286.
crossref pmid pmc pdf
17. Aryan A, Aghajanpour F, Dashtdar M, Hejazi F, Salimi M, Afshar A, et al. Exploring intercellular dynamics: ultra-weak biophoton emission as a novel indicator of altered cell functions and disease in oligospermia mice. J Lasers Med Sci 2023;14:e65.
crossref pmid pmc pdf
18. Soltani R, Abbaszadeh HA, Nazarian H, Tabeie F, Akbari H, Mohammadzadeh I, et al. The impact of photobiomodulation therapy on enhancing spermatogenesis and blood-testis barrier integrity in adult male mice subjected to scrotal hyperthermia. J Lasers Med Sci 2024;15:e43.
crossref pmid pmc pdf
19. Hasani A, Khosravi A, Rahimi K, Afshar A, Fadaei-Fathabadi F, Raoofi A, et al. Photobiomodulation restores spermatogenesis in the transient scrotal hyperthermia-induced mice. Life Sci 2020;254:117767.
crossref pmid
20. Sun W, Ni Z, Li R, Chang X, Li W, Yang M, et al. Flurochloridone induces Sertoli cell apoptosis through ROS-dependent mitochondrial pathway. Ecotoxicol Environ Saf 2021;216:112183.
crossref pmid
21. Afshar A, Aliaghaei A, Nazarian H, Abbaszadeh HA, Naserzadeh P, Fathabadi FF, et al. Curcumin-loaded iron particle improvement of spermatogenesis in azoospermic mouse induced by long-term scrotal hyperthermia. Reprod Sci 2021;28:371-80.
crossref pmid pdf
22. Tabatabaee F, Darabi S, Soltani R, Aghajanpour F, Afshar A, Abbaszadeh HA, et al. Therapeutic effects of exosome therapy and photobiomodulation therapy on the spermatogenesis arrest in male mice after scrotum hyperthermia. J Lasers Med Sci 2024;15:e3.
crossref pmid pmc pdf
23. Moeinian N, Fathabadi FF, Norouzian M, Abbaszadeh HA, Nazarian H, Afshar A, et al. The effects of vitamin C and vitamin B12 on improving spermatogenesis in mice subjected to long-term scrotal heat stress. Clin Exp Reprod Med 2024;51:334-43.
crossref
24. Afshar A, Nazarian H, Fadaefathabadi F, Aghajanpour F, Soltani R, Abdollahifar MA, et al. Maternal exposure to phenanthrene induces testicular apoptosis and Sertoli cell dysfunction in F1 adult male mice: a histological and molecular study. Clin Exp Reprod Med 2025;52:87-97.
crossref
25. Ayoubi M, Naserzadeh P, Hashemi MT, Reza Rostami M, Tamjid E, Tavakoli MM, et al. Biochemical mechanisms of dose-dependent cytotoxicity and ROS-mediated apoptosis induced by lead sulfide/graphene oxide quantum dots for potential bioimaging applications. Sci Rep 2017;7:12896.
crossref pmid pmc pdf
26. Asadi N, Bahmani M, Kheradmand A, Rafieian-Kopaei M. The impact of oxidative stress on testicular function and the role of antioxidants in improving it: a review. J Clin Diagn Res 2017;11:IE01-5.
crossref pmid pmc
27. Karu TI. Mitochondrial signaling in mammalian cells activated by red and near-IR radiation. Photochem Photobiol 2008;84:1091-9.
crossref pmid
28. Yang Y, Huang H, Ba Y, Cheng XM, Cui LX. Effect of oxidative stress on fluoride-induced apoptosis in primary cultured Sertoli cells of rats. Int J Environ Health Res 2015;25:1-9.
crossref pmid
29. Ren GY, Fan XR, Zhang JW, Zhang XR, He JP. Effects of busulfan on expression and localization of proliferation and differentiation related proteins in seminiferous tubules in testis of piglets. J Shanxi Agric Sci 2023;51:1107-14.

30. Facanha EL, de Morais EF, Pinheiro JC, de Melo Fernandes Almeida DR, Morais DB, Barboza CA. Effect of low-level laser therapy on seminiferous epithelium: a systematic review of in vivo studies. Lasers Med Sci 2021;36:259-67.
crossref pmid pdf
31. Aghajanpour F, Soltani R, Afshar A, Abbaszadeh HA, Fadaei Fathabadi F, Moeinian N, et al. Sertoli cell-conditioned medium can improve blood-testis-barrier function and spermatogenesis in azoospermia mice induced by scrotal hyperthermia: an experimental study. Int J Reprod Biomed 2024;22:17-30.
crossref pmid pmc
32. Niu C, Guo J, Shen X, Ma S, Xia M, Xia J, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis. J Cell Mol Med 2020;24:4194-211.
crossref pmid pmc pdf
33. Zhao WP, Wang HW, Liu J, Tan PP, Luo XL, Zhu SQ, et al. Positive PCNA and Ki-67 expression in the testis correlates with spermatogenesis dysfunction in fluoride-treated rats. Biol Trace Elem Res 2018;186:489-97.
crossref pmid pdf
34. Feng Y, Huang Z, Ma X, Zong X, Wu CY, Lee RH, et al. Activation of testosterone-androgen receptor mediates cerebrovascular protection by photobiomodulation treatment in photothrombosis-induced stroke rats. CNS Neurosci Ther 2024;30:e14574.
pmid pmc
35. Salmani S, Razi M, Sarrafzadeh-Rezaei F, Mahmoudian A. Testosterone amplifies HSP70-2a, HSP90 and PCNA expression in experimental varicocele condition: implication for DNA fragmentation. Reprod Biol 2020;20:384-95.
crossref pmid
36. Ferramosca A, Provenzano SP, Coppola L, Zara V. Mitochondrial respiratory efficiency is positively correlated with human sperm motility. Urology 2012;79:809-14.
crossref pmid
37. Zhao RZ, Jiang S, Zhang L, Yu ZB. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int J Mol Med 2019;44:3-15.
crossref pmid pmc
38. Wu S, Zhou F, Wei Y, Chen WR, Chen Q, Xing D. Cancer phototherapy via selective photoinactivation of respiratory chain oxidase to trigger a fatal superoxide anion burst. Antioxid Redox Signal 2014;20:733-46.
crossref pmid pmc
39. Rezaei F, Bayat M, Nazarian H, Aliaghaei A, Abaszadeh HA, Naserzadeh P, et al. Photobiomodulation therapy improves spermatogenesis in busulfan-induced infertile mouse. Reprod Sci 2021;28:2789-98.
crossref pmid pdf
40. Chi H, Chun K, Son H, Kim J, Kim G, Roh S. Effect of genistein administration on the recovery of spermatogenesis in the busulfan-treated rat testis. Clin Exp Reprod Med 2013;40:60-6.
crossref pmid pmc
41. Salman Yazdi R, Bakhshi S, Jannat Alipoor F, Akhoond MR, Borhani S, Farrahi F, et al. Effect of 830-nm diode laser irradiation on human sperm motility. Lasers Med Sci 2014;29:97-104.
crossref pmid pdf
42. Ziaeipour S, Rezaei F, Piryaei A, Abdi S, Moradi A, Ghasemi A, et al. Hyperthermia versus busulfan: finding the effective method in animal model of azoospermia induction. Andrologia 2019;51:e13438.
crossref pmid pdf
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  •   Scopus
  • 4,871 View
  • 41 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next