Clin Exp Reprod Med Search

CLOSE


Clin Exp Reprod Med > Volume 52(4); 2025 > Article
Abdolmaleki, Amirsayyafi, Khazaiel, Jalili, Mansourhi, and Bakhtiari: Formulation of Paeonia lactiflora root extract can induce atrophy of endometriotic lesions and accelerate embryo implantation following in vitro fertilization in endometriosis: An experimental study

Abstract

Objective

Endometriosis (Endo) involves inflammation and angiogenesis within lesions, potentially causing embryo implantation failure and infertility. Paeonia lactiflora (PL) root exhibits anti-angiogenic and anti-inflammatory properties. This experimental study investigated the therapeutic effects of PL on endometriotic lesion atrophy and embryo implantation following in vitro fertilization (IVF).

Methods

Female mice (n=32) were allocated into various treatment and sham groups. Endo was induced through xenograft transplantation of rat endometrium onto the anterior abdominal walls of recipient (Endo) mice. PL root was extracted, phytochemically characterized, and orally administered (1.06 mg PL/20 g mouse) for 17 consecutive days. Through IVF, cultured mouse embryos were implanted into Endo mouse uteri. Ten days post-IVF, samples were collected, including intra-abdominal fluid for the measurement of vascular endothelial growth factor (VEGF) and tumor necrosis factor α (TNF-α) using enzyme-linked immunosorbent assay. Embryo-containing uteri underwent trypan blue staining, while uterus fragments were stained with hematoxylin and eosin and analyzed for leukemia inhibitory factor (LIF) gene expression using quantitative polymerase chain reaction. The number of embryo implantation sites and diameter of endometriotic lesions were recorded. Data were analyzed using SPSS ver. 19, with p-values <0.05 considered to indicate statistical significance.

Results

Following Endo induction, TNF-α and VEGF levels increased, as did lesion diameter (p<0.05). LIF gene expression and the embryo implantation rate decreased (p<0.05). After PL extract administration to Endo mice, TNF-α levels, VEGF levels, and lesion diameter decreased (p<0.05), while LIF gene expression and implantation rate increased (p<0.05).

Conclusion

PL extract (1.06 mg/20 g mouse) decreases TNF-α and VEGF levels, suppressing inflammation and angiogenesis and causing endometriotic lesion atrophy. Furthermore, PL increases uterine LIF gene expression, promoting successful implantation post-IVF in Endo mice.

Introduction

The endometrium, which is the inner lining of the uterus, thickens during pregnancy to prepare for embryo implantation and is shed, along with blood and tissue, during menstruation. Endometriosis (Endo) is a gynecological condition characterized by the growth of tissue resembling the endometrium outside the uterus, most commonly within the abdominal cavity [1]. Although the exact pathophysiology of Endo remains elusive, its symptoms can include pelvic pain, dysmenorrhea, dyspareunia, pain during bowel movements or urination, excessive bleeding, and, notably, infertility [2]. Four primary tissue responses are observed in the pathology of Endo: inflammation, attachment, angiogenesis, and proliferation [3].
Phytomedicine involves using herbal formulations to treat or alleviate human ailments. It plays a key role in modern medicine, contributing to drug development and healthcare. Research has indicated that phytomedicine can provide substantial therapeutic benefits and lead to the discovery of new drugs. Paeonia lactiflora (PL), commonly known as the Chinese peony, is an herbaceous perennial flowering plant native to central and eastern Asia. PL is known for its anti-inflammatory and anti-angiogenic properties [4]. It exerts anti-inflammatory effects by inhibiting the production of inflammatory mediators such as prostaglandin E2, leukotriene B4, and nitric oxide [5]. Furthermore, this herb possesses immunomodulatory properties, affecting lymphocyte proliferation, the differentiation of Th/Ts lymphocytes, and the production of proinflammatory cytokines [6]. PL also demonstrates anti-angiogenic properties by inhibiting angiogenesis [7].
In vitro fertilization (IVF) is a widely used laboratory technique that can assist women experiencing infertility related to Endo. IVF enables the circumvention of potential disruptions in reproductive function attributed to Endo, including ovulatory dysfunction, impaired oocyte maturation, altered embryo cleavage, implantation difficulties, or extensive pathological adhesions from endometriotic lesions [8]. The efficacy of IVF as a treatment for Endo-associated infertility is well-established in the scientific community, helping many women with this condition achieve pregnancy.
Accordingly, in this experimental study, the authors sought to evaluate the anti-Endo effects of PL in female Navar Medical Research Institute (NMRI) mice with induced Endo (termed Endo mice) and subsequent IVF.

Methods

1. Ethical considerations

This experimental study was conducted at Kermanshah University of Medical Sciences in Kermanshah, Iran. All experimental procedures were carried out under the supervision of the university’s ethics committee (IR.KUMS.REC.1399.994). Animal handling was performed in accordance with the ethical principles outlined in the Declaration of Helsinki of 1975 and revised in 2000 [9].

2. Animal groups

This study utilized 32 female NMRI mice (n=8 per group, aged 8–12 weeks, weighing approximately 30 g). The protocol involved a 30-day period for Endo induction and successful transplantation, followed by a 17-day course of drug administration and subsequent IVF induction. Tissue samples were collected 10 days after IVF. The animals were divided into four groups: treatment (Endo/PL/IVF), Sham 1 (Endo/normal saline [NS]/IVF), Sham 2 (Endo/PL/natural mating [Mate]), and Sham 3 (Endo/NS/Mate).

3. PL extraction

A fresh sample of PL was obtained from the Center of Herbal Medicine and Medicinal Plants (No. PL.1398/AS125). The PL root was separated and cleaned. The root fragments were then shade-dried for 1 week and subsequently ground using an industrial grinder (product SKU: 51879, Iran). Following this, 100 g of the PL root powder was boiled in water for 2 hours. The resulting sediments were discarded, and the supernatant was centrifuged twice at 4,000 rpm for 15 minutes each time. This solution was then mixed with 70% ethanol in a 1:5 ratio of PL to ethanol. The mixture was incubated at 4 °C for 72 hours. After incubation, the solution was centrifuged again twice under the same conditions. The solution, containing the active ingredients of PL, was incubated for an additional 7 days at 37 °C to allow for alcohol evaporation. The final sediment was collected as the PL extract for oral administration [10].

4. Semi-quantitative phytochemical screening

PL powder was percolated with 80% ethanol. Thin-layer chromatography (TLC) on silica gel (Merck) was employed to identify compounds in the ethanol extract. The Liebermann-Burchard reagent and a hexane/ethyl acetate mixture (1:1 ratio) were used to detect terpenes and sterols. Classical acid/base extraction was employed for alkaloid analysis, using TLC in a chloroform/methanol/ammonia solution (25%) with a ratio of 8:2:0.5. For flavonoid detection, TLC was developed in a n-butanol/acetic acid/water mixture (4:1:5 ratio). A 1% aluminum chloride solution in methanol was used for the identification of tannins and saponins [11].

5. Calculation of lethal dose 50 and dose determination of PL extract

The calculation of the lethal dose 50 (LD50) value for PL was performed in accordance with the guidelines provided by the Organisation for Economic Co-operation and Development. PL was administered in a range of doses, with nine different levels (n=5 mice per group) including 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, and 2 mg of PL per 20 g mouse daily for 17 days. Mortality was documented, and a probit table was utilized for regression analysis as per the established protocol [12].

6. Endo induction via rat-to-mouse xenograft endometrial transplantation

Transplant donor rats, which had experienced at least one pregnancy, were housed in a specially designed cage with a metal barrier allowing indirect contact with male rats, maintaining a ratio of two females to one male. This arrangement was sustained for 2 weeks to induce high serum levels of estrous cycle hormones, promoting endometrial thickening. Subsequently, the transplant donors were anesthetized with an intraperitoneal (IP) injection of 50 IU of a diazepam-ketamine mixture (90 IU of diazepam and 10 IU of ketamine; ketamine hydrochloride, 50 mg/mL, Rotexmedica; diazepam, 10 mg/2 mL, Caspian Tamin Pharmaceutical Co.). Laparotomy was performed along the midline of each donor rat, and the uterus was excised and placed in a dish with phosphate-buffered saline solution. The endometrium was separated from the myometrium and perimetrium, and 5-mm diameter fragments were prepared using a vernier caliper (code 200-1205; INSIZE Co. Ltd.) and a dermal punch (AlMasoom Co.). The recipient mice were then anesthetized, and the uterine fragments were grafted onto the anterior abdominal wall using non-absorbable sutures, following a previously published protocol that placed the luminal surface of the endometrium in direct contact with the peritoneal surface of the abdominal wall. The abdominal incision was closed with polyvinylidene fluoride sutures (5.0 USP; BARTAR). To stimulate estrogen secretion, which is essential for the successful induction of endometrial lesions, the recipient mice were placed in a cage adjacent to male mice, separated by a metal barrier, for 30 days. All aforementioned protocols were conducted in accordance with a study by Abdolmaleki et al. [13] (Figure 1).

7. Oral PL administration protocol

Starting 1 day after Endo surgery (day 31 post-induction), the animals received an oral dose of 1.06 mg PL per 20 g of mouse body weight at 10:00 AM daily for 17 consecutive days [14].

8. Embryo culture and transfer in IVF

T6 cell culture (Sigma-Aldrich) containing bovine serum albumin (BSA; SKU: 10735078001, 50 g; Sigma-Aldrich) was prepared at a ratio of T6 to BSA of 1:6 and sterilized using a filter membrane (13 mm, 0.22 μm) for embryo culture and injection. This was done using a mineral oil-based dropping method. Pregnant mare serum gonadotropin (PMSG, 5,000 IU; HIPRA) and human chorionic gonadotropin (hCG, 5,000 IU) hormones were procured. For ovarian hyperstimulation, PMSG was administered at a concentration of 10 IU/mL via IP injection. Forty-eight hours later, hCG was injected at the same concentration and by the same route. Oocyte retrieval occurred 14 hours after the hCG injection. During this procedure, laparotomy was performed, and pre-ovulatory oocytes (metaphase II) were collected using mouth pipetting. For sperm preparation, male NMRI mice were euthanized by cervical dislocation after being anesthetized. The epididymides were excised, and the sperm was released into dishes. Subsequently, the IVF process was carried out according to standard protocols. Blastocysts were assessed daily, and embryos were graded using the Gardner protocol [15]. Pseudopregnancy was induced in recipient mice 60 hours prior to embryo transfer. Blastocysts were then transferred into the intrauterine cavity of the recipient mice using an embryo transfer catheter and a mouth pipette, with 10 embryos transferred per mouse [16].

9. Tissue sampling protocols

Ten days after blastocyst implantation, the animals were anesthetized and euthanized via cervical dislocation. Trypan blue (2 μL, 0.4%) was injected into the tail vein to stain the uterus and facilitate counting of embryo implantation sites. NS (1 cc) was injected into the peritoneal cavity, then aspirated 3 minutes later for an enzyme-linked immunosorbent assay (ELISA) to measure IP cytokines, specifically tumor necrosis factor α (TNF-α) and vascular endothelial growth factor (VEGF). Midline laparotomy was performed, and the transplanted endometriotic lesions were excised and their diameters measured. The samples were then fixed in formalin solution (Cat. No. 104402; Merck) for histopathological evaluation, including hematoxylin and eosin (H&E) staining. The uterus was dissected to count the implantation sites, and the right uterine horn was placed in liquid nitrogen for genetic expression analysis of the leukemia inhibitory factor (LIF) gene [17].

10. Histopathological assessment using H&E staining

After fixation in 10% formalin, the samples underwent processing using a tissue processor machine (TP120; DID SABZ Co.). During this process, the samples were dehydrated in ascending concentrations of ethyl alcohol. Xylene (Cat. No. 108633; AvecinaShimi Co.) was utilized to clear the samples, and paraffin was employed for tissue impregnation. The samples were then embedded in paraffin and sectioned with a microtome. H&E staining (SinaClon Co.) was performed, and the samples were subsequently prepared for microscopic examination [18].

11. Assessment of LIF gene expression using quantitative polymerase chain reaction

The uterine samples were processed using micropestles, and RNA was subsequently extracted from the tissues using an RNA extraction kit (RNX-PLUS solution, Cat. No. EX6101; SinaClon Co.). The quality of the extracted RNA was assessed using NanoDrop spectrophotometry (Synergy H1; BioTek) at 260 nm. The integrity of the RNA was evaluated on a 1% agarose gel. Additionally, RNA purification was performed to eliminate any genomic DNA contamination. Complementary DNA (cDNA) was synthesized using a first-strand cDNA synthesis kit (Cat. No. RT5201; SinaClon Co.) following the manufacturer’s instructions on a thermal cycler (K160 Mini-PCR; Heal Force). Subsequently, quantitative polymerase chain reaction (qPCR) was conducted using SyberBlue (SinaClon Co.) and specific primers for the LIF gene (qPCR machine: StepOne; Applied Biosystems); LIF: F: AAGCCAAGATGATGCCACAG, R: GAGCCCAGAGAGTCCAAGT) [19]. actin beta (ACTB) was used as the internal control (F: TGACCCAGATCATGTTTGAGACC, R: CTCGTAGATGGGCACAGTGTGGG). The data were expressed as fold changes calculated using the 2−ΔΔct method [20].

12. Assessment of TNF-α and VEGF cytokines using ELISA

To quantify the IP cytokines TNF-α and VEGF, standard solutions were prepared in accordance with ELISA kit instructions (Diaclone Co., Cat. No. 950.090.096, supplied by PadGin Teb Co.). Levels of TNF-α and VEGF were measured using an ELISA reader (NanoDrop spectrophotometer, Gen5 software; BioTek) at 450 nm. The standard curve was plotted, and the concentrations of the cytokines were determined. The data were reported in picograms per milliliter (pg/mL) [21].

13. Statistical analysis

The normal distribution of the extracted data was evaluated using the Kolmogorov-Smirnov test. To investigate significant differences among groups, the unpaired t-test and analysis of variance were employed. Data were reported as mean±standard error of the mean, and p-values less than 0.05 were considered to indicate statistical significance. All statistical analyses were performed using SPSS ver. 16 (SPSS Inc.), and graphs were created with GraphPad Prism ver. 9 (GraphPad Software Inc.).

Results

1. Determination of the LD50 of PL extract

For dose determination, concentrations of the PL plant extract were set to range from 0.1 to 2 mg PL per 20 g mouse. No animal mortality was observed at doses from 0.1 to 1 mg PL per 20 g mouse. However, at doses of 1.25, 1.5, 1.75, and 2 mg PL per 20 g mouse, respective mortality rates of 20%, 20%, 60%, and 100% were recorded. The LD50 was precisely determined to be 1.68 mg PL per 20 g mouse. Therefore, in accordance with the study by Choi et al. [14], a therapeutic dose of 1.06 mg PL per 20 g mouse was administered (Table 1).

2. Semi-quantitative phytochemical screening of PL

Biochemically, the PL extract was found to be rich in 9-octadecenoic acid (Z), methyl ester, dodecanoic acid, saponins, and tannins. Additionally, phytochemicals such as flavonoids, phlobatannins, and anthraquinones were detected (Table 2).

3. Change in the size of endometriotic lesions in Endo mice following administration of PL extract

The size of endometriotic lesions was significantly reduced (p<0.05) in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. This significant reduction suggests the therapeutic effects of PL extract in promoting the atrophy of endometriotic lesions. No significant changes (p>0.05) were observed in the other groups (Figure 2).

4. Embryo implantation rate through IVF in Endo mice following administration of PL extract

The number of implantation sites after the IVF procedure and mating was significantly higher (p<0.05) in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. This finding suggests that PL extract may increase the rate of successful embryo implantation in Endo mice following IVF or mating (Figure 3).

5. Histopathologic changes in endometriotic lesions in Endo mice following administration of PL extract

Endometrial tissue samples, characterized by a typical endometrial layer of single cylindrical epithelium (Figure 4A, black arrow) and underlying lamina propria (Figure 4A, yellow arrow), were dissected from the uteri of donor rats in accordance with the published protocol. The lamina propria (Figure 4A, yellow arrow), a form of loose connective tissue, contained various blood vessels (Figure 4A, red arrow) and endometrial glands (Figure 4A, blue arrow). Other uterine tissues, such as the myometrium and perimetrium, were removed during tissue graft preparation. This specific tissue graft (Figure 4A) was utilized for xenograft transplantation to induce Endo. After successful induction, the endometrial layer of the graft underwent proliferation (Figure 4B, yellow arrow), with visible angiogenesis (Figure 4B, red arrow). The inner cavity of the lesions was filled with pus, indicating successful induction of the condition. Upon administering PL extract to the mice with Endo, the blood vessel sections disappeared (Figure 4C), and the diameter of the lamina propria (Figure 4C, yellow arrow) decreased. The routine histological features were altered, leaving only a scar of loose connective tissue (Figure 4C). Consequently, the endometrium layer, lamina propria, and secretory glands were no longer visible. Additionally, partial lymphocytic infiltration was observed (Figure 4C, black arrow). The space between the grafted Endo lesions and the abdominal wall narrowed, leaving only the abdominal muscles of the mice discernible (Figure 4C, 4D, red arrow). In the Sham 1 and Sham 3 groups, which did not receive PL extract, the diameter of the Endo lesions increased markedly (Figure 4E, 4F, yellow arrows) with various sections of blood vessels (Figure 4E, 4F, red arrows). The loose connective layers (lamina propria) of the lesions were replaced by an abnormal, thick scar layer with extensive lymphocytic infiltration (Figure 4E, 4F, black arrows). The inner cavities of the Endo cysts were filled with purulent secretions (Figure 4E, 4F, red bullets).

6. Change in LIF gene expression in Endo mice following administration of PL extract

Genetic evaluations revealed that after administering PL extract to mice with Endo, a significant increase (p<0.05) occurred in the expression of the LIF gene in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. This result suggests that PL extract stimulates LIF gene expression, potentially increasing the rate of embryo implantation in Endo mice. Additionally, no significant difference (p>0.05) was observed between the Sham 1 and Sham 3 groups, indicating that the method of pregnancy (natural mating or IVF) did not significantly impact LIF gene expression (Figure 5).

7. Changes in IP cytokine levels (TNF-α and VEGF) in Endo mice following administration of PL extract

The laboratory investigation into cytokines governing inflammation (TNF-α) and vascular growth (VEGF) in peritoneal fluid revealed that after the administration of PL plant extract, significant reductions (p<0.05) were observed in the levels of TNF-α and VEGF in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. These results suggest that PL extract can effectively diminish inflammation and angiogenesis in Endo mice, leading to the atrophy of endometriotic lesions (Figure 6).

Discussion

Endo is a pathological condition characterized by the retrograde flow of endometrial fragments from the uterus into the peritoneal cavity, followed by the attachment and growth of distinct lesions. These lesions lead to inflammation and angiogenesis in the peritoneum. These two phenomena result in the lesions adhering to the peritoneal layer, representing an environment conducive to the growth of endometrial lesions and causing partial or total infertility. Assisted reproductive technologies such as IVF are often required to treat infertility in these cases [22]. In traditional medicine, the root of the PL plant is widely used to treat various diseases, including rheumatoid arthritis, gastrointestinal disorders, and burns, based on its anti-inflammatory and anti-angiogenic properties [7].
One study explicitly demonstrated that PL extract increases the expression of the LIF gene in the endometrium [14]. This finding is noteworthy because Endo-associated infertility has been linked to reduced LIF gene expression in the endometrium [23]. Given the established role of PL root in reducing endometriotic inflammation and inhibiting angiogenesis, it may be possible to mitigate the pathological effects of Endo caused by these processes. Furthermore, the capacity of this plant to increase LIF gene expression in the endometrium suggests that PL extract could also improve the rate of embryo implantation in individuals with Endo. Thus, this research plan was focused on establishing a laboratory model of Endo using xenograft transplantation, followed by treatment with PL root extract at a dosage of 1.06 mg PL per 20 g mouse weight. To assess the impact of this extract on embryo implantation, an IVF protocol was employed, which is a common treatment for individuals with infertility related to Endo.
Choi et al. [14] determined that an effective dose of PL that can inhibit inflammation and increase the implantation rate is 1.06 mg PL per 20 g mouse. In the present study, the authors defined the LD50 dose as 1.68 mg per 20 g animal. However, in a study conducted by Wu et al. [24] for the treatment of arthritis, the effective substance extracted from the PL was effective in the dose of 0.4 mg/20 g animal.
Although the nutritional content of PL root varies depending on the season in which the plant is harvested, several studies have documented certain constituents. The root of PL is known to contain monoterpenes, monoterpene glycosides (including paeoniflorin and albiflorin), triterpenoids (such as β-sitosterol), daucosterol, benzoic acid, and a variety of vitamins and minerals, including potassium, calcium, phosphorus, magnesium, manganese, iron, copper, and zinc [25]. Paeoniflorin, a type of monoterpene glycoside, exhibits anticancer properties against a range of cancers, including those of the liver, stomach, breast, lung, and pancreas, as well as colorectal cancer, glioma, and leukemia [26]. This compound also possesses anti-inflammatory characteristics [27]. The anticancer effects of paeoniflorin are attributed to its capacity to inhibit cellular proliferation and induce apoptosis [26].
In terms of the reproductive system, this substance exhibits an inhibitory effect on the growth of endometrial carcinoma by activating the mitogen-activated protein kinase (MAPK) and nuclear factor-κB (NF-κB) signaling pathways [28]. Angiogenesis is a fundamental process in the adhesion, growth, and proliferation of endometriotic lesions within the peritoneal cavity [29]. The presence of inflammation during Endo leads to the release of numerous cytokines that affect adjacent blood vessels. Consequently, pericytes, which are normally passively present around the vessels and represent endothelial progenitors, become activated and form new tubular structures, creating new blood vessels [30]. The presence of peritoneal macrophages around and within Endo lesions is also considered a critical factor in the initiation of inflammation. Through various molecular mechanisms, VEGF is secreted by peritoneal macrophages (as well as by transplanted endometrial cells), and then binds to its receptor (kinase insert domain receptor/fetal liver kinase 1 [KDR/Flk-1]) on the surface of vascular endothelial cells, inducing angiogenesis [31]. Vascular endothelial cells possess gap junction communication channels that facilitate cytoplasmic communication with adjacent endothelial cells. During angiogenesis, the morphology, cytoplasmic content, and numerous intracellular activities of endothelial cells are altered. Pro-angiogenic factors regulate and modulate the activity of connexin-like channels. Consequently, connexins are involved in the morphological changes, migration, and connection of endothelial cells during angiogenesis [32]. When the cytokine VEGF is secreted by macrophages, it binds to the VEGF-R2 receptor on vascular endothelial cells and, through a secondary signaling cascade, leads to the closure of connexin channels via the Cx43 signaling pathway. This action results in an increased intracellular level of plasminogen activator inhibitor-1 (PAI-1) and von Willebrand factor (VWF), prompting the endothelial cell to initiate angiogenesis [32].
Based on high-performance liquid chromatography and phytochemical investigations of PL plant root extract, numerous active compounds have been identified that possess cell proliferation inhibitory properties. These include paeoniflorin, pentagalloyl glucose, daucosterol, and catechin. These substances inhibit lesion growth through various mechanisms such as inducing apoptosis via the MAPK signaling pathway and NF-κB, promoting autophagy by increasing intracellular reactive oxygen species, or inhibiting cell proliferation by arresting the cell cycle in the G1 or S phase [5].
To contextualize the findings of this research within the broader scientific literature, it is important to recognize that after transplantation of endometriotic lesions to the abdominal wall, an inflammatory response is initiated, which stimulates angiogenesis. These processes collectively contribute to the proliferation of endometriotic cells. Thus, angiogenesis, inflammation, and endometriotic cell proliferation are the principal factors implicated in the pathogenesis of Endo.
In conclusion, PL root extract contains a variety of effective substances that exhibit anti-angiogenic effects on endometriotic lesions. After the administration of PL root extract, reduced IP levels of the cytokines TNF-α and VEGF were evident. Additionally, the researchers noted degeneration of endometriotic lesions, as well as an increase in LIF gene expression within the uterus. Moreover, a higher rate of successful embryo implantation was found in Endo animals following PL administration. However, further clinical validation is necessary before recommending PL root extract for use in IVF treatments for women with Endo.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: AA, MB. Methodology: AA, MB. Formal analysis: AA, HA, MB. Data curation: AA, HA, MB. Project administration: AA, MB. Writing-original draft: SK, CJ, KM. Writing-review & editing: AA, MB. Approval of final manuscript: AA, HA, SK, CJ, KM, MB.

Figure 1.
Xenograft transplantation of rat endometrial segments (A, B) to mouse abdominal wall (C) for successful induction of endometriosis (D). The arrows represent the intestine (red), the uterine horn (black), the abdominal wall (green), angiogenesis (blue), endometrial lesions (yellow), and endometrial tissue attachment (white). This figure representing the surgical protocol of endometriosis induction was sourced from the study of Abdolmaleki et al. [13].
cerm-2024-07374f1.jpg
Figure 2.
Endometriotic lesion size (mm) in treatment (A) and sham (B: Sham 1; C: Sham 2; and D: Sham 3) groups (n=6 in each). Endo, endometriosis; PL, Paeonia lactiflora; IVF, in vitro fertilization; NS, normal saline; Mate, natural mating. a)Significant changes.
cerm-2024-07374f2.jpg
Figure 3.
Count of implantation sites in treatment (A) and sham (B: Sham 1; C: Sham 2; and D: Sham 3) groups (n=6 in each). Black dashed circles indicate ovaries, while white numbers show successful implanted embryos following in vitro fertilization (IVF) and mating. Endo, endometriosis; PL, Paeonia lactiflora; NS, normal saline; Mate, natural mating. a)Significant changes.
cerm-2024-07374f3.jpg
Figure 4.
(A) Endometrial tissue graft prior to implantation for endometriosis (Endo) induction. (B) Successful Endo transplantation and growth. Black and red bullets indicate the abdominal and luminal cavities of Endo grafted lesions, respectively. Histopathologic changes in endometriotic lesions in treatment (C) and sham (D: Sham 2; E: Sham 1; and F: Sham 3) groups (n=6 in each). Treatment, Endo/Paeonia lactiflora (PL)/in vitro fertilization (IVF); Sham 1, Endo/normal saline (NS)/IVF; Sham 2, Endo/PL/natural mating (Mate); Sham 3, Endo/NS/Mate.
cerm-2024-07374f4.jpg
Figure 5.
Changes in leukemia inhibitory factor (LIF) gene expression in treatment and sham groups (n=6 in each). Endo, endometriosis; PL, Paeonia lactiflora; IVF, in vitro fertilization; Mate, natural mating; NS, normal saline. a)Significant changes.
cerm-2024-07374f5.jpg
Figure 6.
Levels of intraperitoneal cytokines (A: tumor necrosis factor α [TNF-α]; and B: vascular endothelial growth factor [VEGF]) in treatment and sham groups (n=6 in each). Treatment, endometriosis (Endo)/Paeonia lactiflora (PL)/in vitro fertilization (IVF); Sham 1, Endo/normal saline (NS)/IVF; Sham 2, Endo/PL/natural mating (Mate); Sham 3, Endo/NS/Mate. a)Significant changes.
cerm-2024-07374f6.jpg
Table 1.
Various doses of PL extract administered to mice for LD50 determination
Determined concentration (mg PL/20 g mouse) Concentration (log10) Mortality rate (%) Probit value
0.1 −1 0 1.03
0.25 −0.602059991 0 1.03
0.5 −0.301029996 0 1.03
0.75 −0.124938737 0 1.03
1 0 0 1.03
1.25 0.096910013 20 4.16
1.5 0.176091259 20 4.16
1.75 0.243038049 60 5.25
2 0.301029996 100 8.95

PL, Paeonia lactiflora; LD50, lethal dose 50.

Table 2.
Phytochemical screening of hydroalcoholic extracts of PL
Phytochemical assays PL extract
Saponins ++
Flavonoids ++
Alkaloids +
Tanninss ++
Anthraquinones +
Phlobatannins +
9‐Octadecenoic acid (Z), methyl ester ++
Dodecanoic acid ++

+ represents mild presence and ++ strong presence of PL.

PL, Paeonia lactiflora.

References

1. Saunders PT, Horne AW. Endometriosis: etiology, pathobiology, and therapeutic prospects. Cell 2021;184:2807-24.
crossref pmid
2. Filip L, Duica F, Pradatu A, Cretoiu D, Suciu N, Cretoiu SM, et al. Endometriosis associated infertility: a critical review and analysis on etiopathogenesis and therapeutic approaches. Medicina (Kaunas) 2020;56:460.
crossref pmid pmc
3. Bulun SE, Yildiz S, Adli M, Chakravarti D, Parker JB, Milad M, et al. Endometriosis and adenomyosis: shared pathophysiology. Fertil Steril 2023;119:746-50.
crossref pmid
4. Fan Y, Wang Q, Dong Z, Yin Y, Teixeira da Silva JA, Yu X. Advances in molecular biology of Paeonia L. Planta 2019;251:23.
crossref pmid pdf
5. Kim MJ, Kang HH, Seo YJ, Kim KM, Kim YJ, Jung SK. Paeonia lactiflora root extract and its components reduce biomarkers of early atherosclerosis via anti-inflammatory and antioxidant effects in vitro and in vivo. Antioxidants (Basel) 2021;10:1507.
crossref pmid pmc
6. Chen Y, Li H, Zhang XL, Wang W, Rashed MM, Duan H, et al. Exploring the anti-skin inflammation substances and mechanism of Paeonia lactiflora Pall. Flower via network pharmacology-HPLC integration. Phytomedicine 2024;129:155565.
crossref pmid
7. Deng H, Yan C, Xiao T, Yuan D, Xu J. Total glucosides of Paeonia lactiflora Pall inhibit vascular endothelial growth factor-induced angiogenesis. J Ethnopharmacol 2010;127:781-5.
crossref pmid
8. Invernici D, Reschini M, Benaglia L, Somigliana E, Galati G, La Vecchia I, et al. The impact of endometriosis on IVF efficacy: qualitative and quantitative assessment of ovarian response and embryo development. Reprod Biomed Online 2022;45:275-81.
crossref pmid
9. Carlson RV, Boyd KM, Webb DJ. The revision of the Declaration of Helsinki: past, present and future. Br J Clin Pharmacol 2004;57:695-713.
crossref pmid pmc
10. Ghanbari A, Jalili C, Abdolmaleki A, Zhaleh M, Zarinkhat A, Akhshi N. Falcaria vulgaris L. hydroalcoholic extract protects against harmful effects of mercuric chloride on the rat kidney. Avicenna J Phytomed 2023;13:442-53.
pmid pmc
11. George VC, Kumar DR, Suresh PK, Kumar RA. Antioxidant, DNA protective efficacy and HPLC analysis of Annona muricata (soursop) extracts. J Food Sci Technol 2015;52:2328-35.
crossref pmid pmc pdf
12. Bedi O, Krishan P. Investigations on acute oral toxicity studies of purpurin by application of OECD guideline 423 in rodents. Naunyn Schmiedebergs Arch Pharmacol 2020;393:565-71.
crossref pmid pdf
13. Abdolmaleki A, Jalili C, Mansouri K, Bakhtiari M. New rat to mouse xenograft transplantation of endometrium as a model of human endometriosis. Animal Model Exp Med 2021;4:268-77.
crossref pmid pmc pdf
14. Choi HJ, Chung TW, Park MJ, Lee KS, Yoon Y, Kim HS, et al. Paeonia lactiflora enhances the adhesion of trophoblast to the endometrium via induction of leukemia inhibitory factor expression. PLoS One 2016;11:e0148232.
crossref pmid pmc
15. Go KJ. Gardner DK, Weissman A, Howles CM, Shoham Z, editors. Textbook of assisted reproductive techniques: laboratory and clinical perspectives. Andover, Hampshire, United Kingdom: Thomas Publishing Services, 2001: 1–768. Price: $125.00. Fertil Steril 2002;78:1357-8.
crossref
16. Stone BJ, Steele KH, Men H, Srodulski SJ, Bryda EC, Fath-Goodin A. A nonsurgical embryo transfer technique for fresh and cultured blastocysts in rats. J Am Assoc Lab Anim Sci 2020;59:488-95.
crossref pmid pmc
17. Ghanbari A, Jalili C, Abdolmaleki A, Shokri V. Effects of cisplatin and acacetin on total antioxidant status, apoptosis and expression of OCTN3 in mouse testis. Biotech Histochem 2022;97:185-91.
crossref pmid
18. Shabanizadeh A, Roshankhah S, Abdolmaleki A, Salahshoor MR. Properties of Solanum melongena green calyx against toxic effects of diabetes‐induced testopathy: a stereological and biochemical study. Adv Tradit Med 2022;22:569-79.
crossref pdf
19. Fukui Y, Hirota Y, Saito-Fujita T, Aikawa S, Hiraoka T, Kaku T, et al. Uterine epithelial LIF receptors contribute to implantation chamber formation in blastocyst attachment. Endocrinology 2021;162:bqab169.
crossref pmid pdf
20. Moradi Maryamneghari S, Shokri-Asl V, Abdolmaleki A, Jalili C. Genetic, biochemical and histopathological evaluations of thymoquinone on male reproduction system damaged by paclitaxel in Wistar rats. Andrologia 2021;53:e14192.
crossref pmid
21. Asghari R, Shokri-Asl V, Rezaei H, Tavallaie M, Khafaei M, Abdolmaleki A, et al. Alteration of TGFB1, GDF9, and BMPR2 gene expression in preantral follicles of an estradiol valerate-induced polycystic ovary mouse model can lead to anovulation, polycystic morphology, obesity, and absence of hyperandrogenism. Clin Exp Reprod Med 2021;48:245-54.
crossref pmid pmc pdf
22. Bonavina G, Taylor HS. Endometriosis-associated infertility: from pathophysiology to tailored treatment. Front Endocrinol (Lausanne) 2022;13:1020827.
crossref pmid pmc
23. Moberg C, Bourlev V, Ilyasova N, Olovsson M. Endometrial expression of LIF and its receptor and peritoneal fluid levels of IL-1α and IL-6 in women with endometriosis are associated with the probability of pregnancy. Arch Gynecol Obstet 2015;292:429-37.
crossref pmid pdf
24. Wu D, Chen J, Zhu H, Xiong XG, Liang QH, Zhang Y, et al. UPLC-PDA determination of paeoniflorin in rat plasma following the oral administration of Radix Paeoniae Alba and its effects on rats with collagen-induced arthritis. Exp Ther Med 2014;7:209-17.
crossref pmid pmc
25. Li W, Yang S, Cui H, Hua Y, Tao J, Zhou C. Nutritional evaluation of herbaceous peony (Paeonia lactiflora Pall.) petals. Emir J Food Agric 2017;29:518-31.

26. Xiang Y, Zhang Q, Wei S, Huang C, Li Z, Gao Y. Paeoniflorin: a monoterpene glycoside from plants of Paeoniaceae family with diverse anticancer activities. J Pharm Pharmacol 2020;72:483-95.
crossref pmid pdf
27. Wang C, Yuan J, Wu HX, Chang Y, Wang QT, Wu YJ, et al. Paeoniflorin inhibits inflammatory responses in mice with allergic contact dermatitis by regulating the balance between inflammatory and anti-inflammatory cytokines. Inflamm Res 2013;62:1035-44.
crossref pmid pdf
28. Zhang J, Wang F, Wang H, Wang Y, Wu Y, Xu H, et al. Paeoniflorin inhibits proliferation of endometrial cancer cells via activating MAPK and NF-κB signaling pathways. Exp Ther Med 2017;14:5445-51.
crossref pmid pmc
29. Sillem M, Prifti S, Koch A, Neher M, Jauckus J, Runnebaum B. Regulation of matrix metalloproteinases and their inhibitors in uterine endometrial cells of patients with and without endometriosis. Eur J Obstet Gynecol Reprod Biol 2001;95:167-74.
crossref pmid
30. Fujimoto A, Onodera H, Mori A, Isobe N, Yasuda S, Oe H, et al. Vascular endothelial growth factor reduces mural cell coverage of endothelial cells and induces sprouting rather than luminal division in an HT1080 tumour angiogenesis model. Int J Exp Pathol 2004;85:355-64.
crossref pmid pmc
31. Lebovic DI, Bentzien F, Chao VA, Garrett EN, Meng YG, Taylor RN. Induction of an angiogenic phenotype in endometriotic stromal cell cultures by interleukin-1beta. Mol Hum Reprod 2000;6:269-75.
crossref pmid
32. Okamoto T, Usuda H, Tanaka T, Wada K, Shimaoka M. The functional implications of endothelial gap junctions and cellular mechanics in vascular angiogenesis. Cancers (Basel) 2019;11:237.
crossref pmid pmc
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  • 1 Scopus
  • 2,779 View
  • 48 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next