The Yazd Reproductive Science Institute financially supported this study by purchasing all applied materials and animals.
Studies of the effects of estrogens on the male reproductive system have emphasized the role of these hormones in male fertility. Sesame oil has many phytoestrogenic compounds and may improve male fertility. This study investigated the effects of sesame oil and different concentrations of estrogen on sperm parameters and DNA integrity in male mice.
Twenty old NMRI (The Naval Medical Research Institute) male mice (40 weeks; weight, 30–35 g) were treated with sesame oil or different concentrations of estrogen (estradiol, 1 and 10 μL/kg/day) or received no treatment (controls). After 35 days, sperm parameters and DNA integrity were assessed and analyzed.
Sperm count, progressive motility, and morphology were decreased in the group that received 10 μL/kg of estradiol. A remarkably lower percentage of DNA fragmentation and protamine deficiency were detected in the group that received 1 μL/kg of estradiol. In the groups that received sesame oil and 1 μL/kg of estradiol, the numbers of spermatogonia and Leydig cells were higher than in controls. The combination of sesame oil and 1 μL/kg of estradiol led to improved sperm parameters and chromatin and testicular structure.
Based on this study, consumption of sesame oil and a low concentration of estradiol may improve testicular function in older mice.
Spermatogenesis is an essential process in the male reproductive system [
The study was approved by the Animal Ethics Committee of the Yazd Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, Iran (IR.SSU.RSI. REC.1394.5). All protocols were performed according to the National Institute of Health Guidelines for the Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978).
Twenty old NMRI (The Naval Medical Research Institute) male mice (mean age, 40 weeks; weight, 30–35 g) were purchased from the Research and Clinical Center for Infertility, Shahid Sadoughi University of Medical Sciences, Yazd, Iran. All animals were kept in optimal housing and feeding conditions with a controlled temperature (22°C±2°C) and a 12-hour light/dark cycle. The mice were divided into four groups (n=5): the E2-1 group (1 μL/kg/day of estradiol was intraperitoneally injected for 35 days), the E2-10 group (10 μL/kg/day of estradiol was intraperitoneally injected for 35 days), the sesame oil group (10 μL/kg/day of sesame oil was intraperitoneally injected for 35 days), and the control group (no treatment was done).
After 35 days (one cycle of spermatogenesis in mice), animals were sacrificed by cervical dislocation. The left cauda epididymis was removed and cut with a pair of syringes to transferred into Ham's F10 medium for the analysis of sperm parameters and DNA integrity. The left testicular tissue samples were used for the analysis of
After 30 minutes of incubation, sperm count, motility, and morphology were analyzed. A Makler chamber was used for the sperm count. Sperm motility was categorized as progressive, nonprogressive, and immotile spermatozoa. The percentage of sperm cells with normal morphology in the head, neck/mid-piece, and tail were obtained by Diff-Quik staining using light microscopy (×1,000 magnification) (
Aniline blue (AB) staining was applied to evaluate sperm chromatin integrity based on the residual histones in the chromatin structure. Briefly, slides were prepared by smearing, air-drying, and fixing a sperm sample. Then, the sample was incubated for 30 minutes in 3% glutaraldehyde in phosphate-buffered saline (PBS) at room temperature. The smears were stained in 5% aqueous AB solution (pH 3.5) for 10 minutes. Afterward, the slides were rinsed and evaluated at ×1.000 magnification. Immature and/or abnormal spermatozoa with additional histones were seen in dark blue and mature nuclei were detected as light blue (
The percentage of sperm apoptosis was determined by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay using a commercially available kit (In Situ Cell Death Detection Kit, fluorescein, Roche, USA). Spermatozoa with normal DNA show the background fluorescent color, while sperm with high DNA fragmentation has many 3-OH ends, resulting in a strong fluorescent color. Firstly, the smears were fixed in methanol solution for 4 minutes. The slides were washed with PBS for 5 minutes three times. Later, they were incubated with blocking solution for 15–20 minutes at 15°C–25°C in a dark room. Samples were incubated with 0.1% (v/v) Triton X-100 containing 0.1% (w/v) sodium citrate for 10 minutes on ice. Slides were again washed three times with PBS for 5 minutes and were stained with 50 μL of TUNEL reaction mixture for 1 hour at 37°C in a dark and humidified atmosphere. Then, they were examined under a fluorescent microscope at ×1,000 magnification (BX51; Olympus, Tokyo, Japan) (
Protamine deficiency in sperm was analyzed by chromomycin A3 (CMA3), which is bright yellow. The smears were fixed immediately with Carnoy solution for 10 minutes at 4°C. Each slide was treated with 100 μL of CMA3 solution for 10 minutes in a dark room (Sigma-Aldrich, St. Louis, MO, USA). The slides were rinsed in McIrvin buffer and air-dried. The slides were analyzed using fluorescent microscopy with suitable filters (×400 magnification) (
The testis tissue of each mouse was used for RNA extraction. Total RNA was extracted by the QuantiTect, RNeasy Micro kit (Qiagen, Hilden, Germany), following a slight modification of the manufacturer’s protocol in a total volume of 14 μL. Concentrations of extracted RNA were measured by a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). Subsequently, 1,000 ng/μL of extracted total RNA was reverse-transcribed using the Revert Aid First Strand cDNA synthesis kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions. For negative control samples, the reverse transcriptase enzyme or the RNA template was removed from the reactions. Synthetic cDNA was stored at –80°C until quantitative real-time polymerase chain reaction was performed to assess the relative gene expression levels of the genes encoding
Testicular sections were prepared with a 5-μm thickness. Furthermore, hematoxylin and eosin staining was performed to analyze the diameter of seminiferous tubules using an optical microscope (BX51, Olympus). In each section, three fields and at least 20 tubules were randomly selected. In this regard, large and small diameters were measured in each tubule and the average diameter was recorded. The thickness of the germinal epithelium layer was also calculated by subtracting the inner diameter of the tubule from the overall diameter of the seminiferous tubule [
One-way analysis of variance was used to compare the data and Pearson correlation coefficients were used to quantify the relationships between the variables, with
As shown in
Spermatogenesis decreases daily with a rate of 30% in men above 50 years old [
Despite the beneficial effects of high-dose estradiol on testicular function, we recommend that low doses of estradiol or sesame oil may play an important role on optimizing sperm parameters and chromatin quality in older mice.
The authors would like to thank Yazd Reproductive Science Institute for financial support of the current study.
No potential conflict of interest relevant to this article was reported.
Conceptualization: ART, HZZ. Funding acquisition: MM, MP. Methodology: MM, ART. Project administration: AN, SGE. Writing–original draft: ART. Writing–review & editing: AK.
(A) Sperm morphology determined using Diff-Quik staining (×1,000). (B) AB staining assessing sperm chromatin status. Sperm heads with immature nuclear chromatin were shown as dark blue (AB+) and those with mature nuclei (AB–) were detected as light blue (×1,000) (C) TUNEL assay: apoptosis-positive cells are brilliant fluorescent green (TUNEL+) and apoptosis-negative cells are pale and opaque green (TUNEL–) (×1,000). (D) CMA3-positive cells (CMA3+) were seen as bright yellow, whereas cells with no protamine defects stained dark yellow (CMA3–) (×1,000 magnification). AB, aniline blue; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; CMA3, chromomycin A3.
(A) Evaluation of mRNA levels of the β-catenin gene. The E2-1, E2-10 and sesame oil group were intraperitoneally injected with 1 μL/kg/day of estradiol, 10 μL/kg/day of estradiol, and 10 μL/kg/day of sesame oil for 35 days, respectively. (B) Evaluation of mRNA levels of the
Mean and standard error of cell counts in seminiferous tubules in the E2-1, E2-10, and sesame oil groups, which were intraperitoneally injected with 1 μL/kg/day of estradiol, 10 μL/kg/day of estradiol, and 10 μL/kg/day of sesame oil for 35 days, respectively. (A) Spermatogonia cell count, (B) primary spermatocyte cell count, (C) spermatid cell count, (D) Sertoli cell count, (E) Leydig cell count. Significant differences between groups: a)
Mean and standard error of stereological indices of seminiferous tubules in the E2-1, E2-10, and sesame oil groups, which were intraperitoneally injected with 1 μL/kg/day of estradiol, 10 μL/kg/day of estradiol, and 10 μL/kg/day of sesame oil for 35 days, respectively. (A) Lumen diameter (μm), (B) cellular diameter (μm), (C) total diameters (μm) of the tubule. Significant differences between groups: a)
The primers used in real-time PCR
Accession number | Gene | Primer sequence (5'-3') | PCR product (bp) |
---|---|---|---|
NM_009864.3 | F: AGCCATTGCCAAGTACATCC | 133 | |
R: AAAGACCGGCTGGGTAAACT | |||
NM_001165902.1 | F: TCCCATCCACGCAGTTTGAC | 166 | |
R: TCCTCATCGTTTAGCAGTTTTG | |||
NM_007393.5 | F: GTACTCTGTGTGGATCGGTGG | 144 | |
R: AACGCAGCTCAGTAACAGTCC |
PCR, polymerase chain reaction ; F, forward; R, reverse.
Comparison sperm parameters and sperm function tests between control and experimental groups
Variable | Control | E2-1 | E2-10 | Sesame oil |
---|---|---|---|---|
Sperm count (×106/mL) | 27.8±1 | 10.8±1 | 2.6±1 | 21±2 |
Progressive motility (%) | 41±20 | 54.2±1 | 11±1 | 30.2±1 |
Non-progressive motility (%) | 29±9 | 17±6 | 15±8 | 12±5 |
Immotile (%) | 34±14 | 33.8±12 | 80±14 |
62.2±24 |
Normal morphology (%) | 57±3 | 57±16 | 30±0 |
42±6 |
AB (%) | 19±3 | 33±3 |
34±5 |
33±6 |
TUNEL assay (%) | 11±2 | 10±2 | 22±13 | 15±2 |
CMA3 (%) | 20±1 | 22±3 | 29±2 | 28±11 |
Values are presented as mean±standard deviation. The E2-1, E2-10 and sesame oil group were intraperitoneally injected with 1 μL/kg/day of estradiol, 10 μL/kg/day of estradiol, and 10 μL/kg/day of sesame oil for 35 days, respectively.
AB, aniline blue; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; CMA3, chromomycin A3.
Compared to the control group: