Adult male Wistar rats, weighing 220-230 g, were pair-housed and had access to food and water ad libitum. They were on a 12/12 hour light-dark cycle in which the lights went on at 600 hours. All of the experiments were approved by the Board of Research Ethics at Tehran University of Medical Sciences in compliance with the standards of the European Communities Council directive (86/609/EEC). Accordingly, adequate measures were taken to minimize the pain and discomfort of the animals. All of the surgical procedures were carried out under ketamine (75 mg/kg) and xylazine hydrochloric acid (HCl) (10 mg/kg, intraperitoneally) anesthesia administered intraperitoneally. For central administration of AM251 or the vehicle, the rats were fitted with an intracerebroventricular (ICV) guide cannula (22-gauge) positioned in the left lateral cerebral ventricle. The coordinates for implantation were 1 mm lateral, 0.5 mm posterior to the bregma, and 3.2 mm below the surface of the dura [25]. The guide cannula was fixed to the skull with dental cement, and fitted with a dummy cannula to maintain its patency. Eight days post-surgery the animals were injected intracerebroventricularly with the aid of a 30-gauge needle protruding 1 mm from the end of the guide cannula. We injected 5 µL over 5 minutes of either AM251 (Tocris, Bristol, UK) or dimethyl sulfoxide (DMSO, Sigma-Aldrich, Deisenhofen, Germany) as a vehicle control, using a Micro-liter syringe (Hamilton, Reno, NV, USA).

We used immobilization as a model for acute psychophysical stress. The rats were immobilized for one hour in a soft and flexible plastic cone (DecapiCone; Braintree Scientific Inc., Braintree, MA, USA) with a breathing hole at the tip [26-28]. The control rats were kept under routine laboratory housing conditions. All of the experiments were conducted between 800 and 1,200 hours.

To determine whether the stress-induced suppression of the reproductive system is mediated via cannabinoid release, AM251 was used to block endogenous cannabinoid binding. We evaluated the effect of AM251 (N-[piperidin-1-yl]-5-[4-iodophenyl]-1-[2,4-dichlorophenyl]-4-methyl-1H-pyrazole-3-carboxamide) on serum testosterone, corticosterone, and LH concentrations, as well as kiss1 gene expression. On the morning of the experiment, an injection cannula with extension tubing preloaded with the vehicle or drug was inserted into the guide cannula. During the experiment, the distal end of the tube was extended outside of the cage to allow for remote injection without disturbing the animal. Preliminary experiments showed that 1 µg/rat AM251 administered over a period of 5 minutes caused a significant effect. Thirty minutes after drug (1 µg/rat AM251) or vehicle (5 µL/rat DMSO) administration, the rats were exposed to immobilization stress for 1 hour as described above. Sham-operated and vehicle-treated groups were also included in the experiments. When these were compared to each other we observed no significant differences.

It is known that in rats, kiss1 mRNA is down-regulated 5 hours after immobilization stress induction [28]. Therefore, the rats were decapitated and their brain tissue was collected 5 hours after stress induction. The control animals were not exposed to immobilization stress or any injection, but their tissue was collected in a similar fashion. The brains were cut into 300-µm sections in a vibroslicer (752 M, Campden Instruments, Loughborough, UK). Bilateral punches of the medial preoptic area (mPOA) (including the anteroventral periventricular nucleus, AVPV), were taken from bregma +0.2 to -0.6 mm. The arcuate (ARC) nucleus punches were made by a single midline punch from bregma -1.6 to -3.9 mm according to the rat brain atlas of Paxinos and Watson [25]. To confirm the identity of the punched nuclei, sections were fixed with formalin after punching and stained with crystal violet to be observed under a light microscope (Olympus BX50, Tokyo, Japan).

To prepare samples for RT-qPCR, total RNA was extracted from the punched-out tissues of each rat using an RNeasy lipid tissue mini kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. Next, 1 µg of total RNA was used to synthesize cDNA with a Quanti-Tect reverse transcription kit (Qiagen). The expression levels of kiss1 mRNA in the mPOA and ARC were determined by RT-qPCR, using β-actin as a reference gene. For TaqMan qPCR, specific primers and probes were designed and synthesized (Bioneer, Seoul, South Korea); kiss1: (sense) TGATCTCGCTGGCTTCTTG, (antisense) AGGCATTAACGAGTTCCTGG, and TaqMan probe: FAM-TGAACCCACAGGCCAACAGTCCTAMRA; β-actin: (sense) CACTTTCTACAATGAGCTGCG, (antisense) CTGGATGGCTACGTACATGG, and TaqMan probe: FAM-TCTGGGTCATCTTTTCACGGTTGGC-TAMRA. The qPCR was performed using Premix Ex Taq (Probe qPCR; TaKaRa, Shiga, Japan) accompanied by 200 nM primers and 200 nM probes. The experiments were carried out in a Rotor-Gene 2006 (Corbett Research, Mortlake, NSW, Australia). The copy number of the kiss1 transcript was normalized to the ratio of the β-actin transcript for each sample. To calculate the normalized relative gene expression levels (fold induction), the qPCR data were analyzed using the Relative Expression Software Tool (REST) [29]. Here, the mathematical model is based on mean threshold cycle differences (delta-delta C_T) between the sample and the control group.

All serum hormone levels were assessed by double antibody enzyme-linked immunosorbent assay (ELISA). Blood samples were collected from the retro-orbital plexus before and after stress, centrifuged at 3,000 rpm for 15 minutes, and the serum was extracted and stored at -20℃ until use. The serum corticosterone concentration was measured using a rat corticosterone kit (corticosterone, ELISA, DRG, Marburg, Germany); the sensitivity of the corticosterone assay (95% confidence interval at 0 nmol/L) was 1.631 nmol/L. Serum LH was assessed using a rat LH kit (ELISA, Cusabio Biotech, Wuhan, China); the sensitivity of the LH assay was 0.15 mIU/mL. The sensitivity of the testosterone kit (ELISA, Diagnostics Biochem Canada Inc., Ontario, Canada) was 0.022 ng/mL.

Quantification of mRNA expression for kiss1 and β-actin, carried out on all micropunched tissue samples, are presented as mean±SE. Differences in the relative mRNA expression between the control and AM251-treated animals were assessed by using a pair-wise fixed real-location randomization t-test using REST. This tool enables a correction of the qPCR efficiencies and the mean crossing point deviation between the treated and control animals [29]. Tests to assess possible differences in variances were performed in all comparisons. Comparison between two groups was carried out using the unpaired two-tailed Student's t-test. One-way analysis of variance was used, followed by the pair-wise Bonferroni test, to compare three or more groups simultaneously. Non-parametric (Wilcoxon's signed-rank test or Kruskal-Wallis) tests were applied in comparisons that did not show equal variances. Statistical analysis was performed using ver. 3.0 Graphpad Software Inc., San Diego, CA, USA. For all of the data, the alpha level was set at p≤0.05.

To verify HPA axis activation in the immobilization stress model, we measured the serum corticosterone concentrations before and after stress induction. The serum corticosterone concentration increased after stress induction (p=0.04) (Figure 1). The corticosterone levels of the control animals that did not receive an ICV cannula were similar to the levels of the rats before stress, and significantly lower than the levels after stress induction (p=0.04) (Figure 1). This confirms the activation of the HPA axis after 1 hour of immobilization, as has been shown by Kinsey-Jones et al. [28].

To measure the effects of the stressor on peripheral hormones, we studied serum LH and testosterone levels. One hour of immobilization stress decreased the serum LH levels significantly when compared with pre-stress values (post-stress 5.6±1.46 mIU/mL vs. prestress 8.43±1.72 mIU/mL or non-stressed 9.01±1.59 mIU/mL, p=0.00 for both; n=6 for all groups) (Figure 2). To test whether the stress-induced decrease in serum LH concentration is mediated via cannabinoid receptors in the central nervous system, we examined the effect of AM251 on this response. Central administration of AM251 30 minutes before the onset of immobilization stress effectively and significantly increased the post-stress LH serum level compared with that of the stress group (p=0.03) (Figure 2B). According to Wilcoxon's signed rank test, stress led to a non-significant trend towards suppression of serum testosterone in the stress group (p=0.1) (Figure 3). Treatment with AM251 (1 µg/rat) increased the trend of the serum testosterone level compared with the stress group. The difference between the pre-and post-stress serum testosterone levels in each group was not significant (Figure 3).

Using RT-qPCR, we assessed the central effects of the stressor on the HPG axis. We found that acute immobilization stress led to a significant decrease in the kiss1 mRNA level in the mPOA, compared with the controls (Figure 4). We did not see any significant differences in the kiss1 mRNA expression in the ARC (Figure 4). Administration of AM251 30 minutes before stress induction significantly increased the kiss1 mRNA level in the mPOA, but not in the ARC, when compared to the vehicle-treated group.